ID: 924919104

View in Genome Browser
Species Human (GRCh38)
Location 1:248607480-248607502
Sequence CATAATTTGCATAAATTGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924919104_924919105 -7 Left 924919104 1:248607480-248607502 CCGTTCAATTTATGCAAATTATG No data
Right 924919105 1:248607496-248607518 AATTATGCAATTTCAATTTATGG No data
924919104_924919106 6 Left 924919104 1:248607480-248607502 CCGTTCAATTTATGCAAATTATG No data
Right 924919106 1:248607509-248607531 CAATTTATGGAAATTAGAAATGG No data
924919104_924919107 10 Left 924919104 1:248607480-248607502 CCGTTCAATTTATGCAAATTATG No data
Right 924919107 1:248607513-248607535 TTATGGAAATTAGAAATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924919104 Original CRISPR CATAATTTGCATAAATTGAA CGG (reversed) Intergenic
No off target data available for this crispr