ID: 924919904

View in Genome Browser
Species Human (GRCh38)
Location 1:248617941-248617963
Sequence AGTGTTTACCACTCAGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924919902_924919904 -7 Left 924919902 1:248617925-248617947 CCTTTTTTGAAACATAAGTGTTT No data
Right 924919904 1:248617941-248617963 AGTGTTTACCACTCAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924919904 Original CRISPR AGTGTTTACCACTCAGTGAA GGG Intergenic
No off target data available for this crispr