ID: 924921930

View in Genome Browser
Species Human (GRCh38)
Location 1:248639087-248639109
Sequence TGTGGAGGCGGGAGTCCATG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 2, 1: 2, 2: 0, 3: 25, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924921923_924921930 16 Left 924921923 1:248639048-248639070 CCATGATGGAGAGCTGGCTGAGC 0: 2
1: 3
2: 5
3: 20
4: 188
Right 924921930 1:248639087-248639109 TGTGGAGGCGGGAGTCCATGTGG 0: 2
1: 2
2: 0
3: 25
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924921930 Original CRISPR TGTGGAGGCGGGAGTCCATG TGG Exonic