ID: 924927752

View in Genome Browser
Species Human (GRCh38)
Location 1:248699686-248699708
Sequence TCATCTCTCTGGTGGATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924927752_924927755 -10 Left 924927752 1:248699686-248699708 CCTTCAATCCACCAGAGAGATGA No data
Right 924927755 1:248699699-248699721 AGAGAGATGATCAAAAGCCAAGG No data
924927752_924927756 -3 Left 924927752 1:248699686-248699708 CCTTCAATCCACCAGAGAGATGA No data
Right 924927756 1:248699706-248699728 TGATCAAAAGCCAAGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924927752 Original CRISPR TCATCTCTCTGGTGGATTGA AGG (reversed) Intergenic