ID: 924927752 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:248699686-248699708 |
| Sequence | TCATCTCTCTGGTGGATTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924927752_924927755 | -10 | Left | 924927752 | 1:248699686-248699708 | CCTTCAATCCACCAGAGAGATGA | No data | ||
| Right | 924927755 | 1:248699699-248699721 | AGAGAGATGATCAAAAGCCAAGG | No data | ||||
| 924927752_924927756 | -3 | Left | 924927752 | 1:248699686-248699708 | CCTTCAATCCACCAGAGAGATGA | No data | ||
| Right | 924927756 | 1:248699706-248699728 | TGATCAAAAGCCAAGGTCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924927752 | Original CRISPR | TCATCTCTCTGGTGGATTGA AGG (reversed) | Intergenic | ||