ID: 924929997

View in Genome Browser
Species Human (GRCh38)
Location 1:248721999-248722021
Sequence GTGGTAGTCATCCAGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924929989_924929997 28 Left 924929989 1:248721948-248721970 CCAGGGCAAGGACAGCAGCTGGT 0: 1
1: 1
2: 4
3: 37
4: 294
Right 924929997 1:248721999-248722021 GTGGTAGTCATCCAGTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 103
924929996_924929997 -9 Left 924929996 1:248721985-248722007 CCTGGTTCTCAGTAGTGGTAGTC 0: 1
1: 0
2: 2
3: 5
4: 53
Right 924929997 1:248721999-248722021 GTGGTAGTCATCCAGTTTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924929997 Original CRISPR GTGGTAGTCATCCAGTTTGA AGG Intronic
903593187 1:24472669-24472691 GTGGAAACCAGCCAGTTTGACGG + Intronic
906754334 1:48294402-48294424 GTGGTAGTGAGATAGTTTGAGGG - Intergenic
911970256 1:104425890-104425912 GTGGTGTTCACCCAGATTGAGGG - Intergenic
915667446 1:157458048-157458070 GTGGCAATCTTCCAGTTTAATGG + Intergenic
917679076 1:177347944-177347966 GTTGTATTCATCCAGTTTTGAGG + Intergenic
917941775 1:179929181-179929203 GTGGAAGTCATCCCTTTTGAAGG + Intergenic
919496670 1:198280463-198280485 GCTGTAGTTATCCAGTCTGAAGG + Intronic
924293594 1:242563486-242563508 ATGGTGCTCATCCAGATTGAGGG - Intergenic
924929997 1:248721999-248722021 GTGGTAGTCATCCAGTTTGAAGG + Intronic
1065399763 10:25285649-25285671 ATGGTACTCACCCACTTTGAGGG + Intronic
1067125326 10:43510903-43510925 GTGGCAATCTTCCAGTTTAATGG + Intergenic
1067354850 10:45514536-45514558 GAGGAAGTAGTCCAGTTTGATGG - Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1081323531 11:41718784-41718806 ATGGTGCTCATCCAGATTGAAGG - Intergenic
1086342264 11:85858352-85858374 GTGGTAGTGATCTGGCTTGAAGG - Intronic
1092381847 12:8003024-8003046 GTGGCAATCTTCCAGTTTAACGG - Intergenic
1093885708 12:24457791-24457813 GTGGTAGTCATCCTATATGTTGG - Intergenic
1096587109 12:52629939-52629961 GTGGAAGGCATACAGGTTGAGGG - Intergenic
1096896735 12:54828539-54828561 GTGGTACTCACCCACATTGAGGG + Intergenic
1101865603 12:108517520-108517542 GTAGGAGTCATCCAGGGTGAAGG + Intronic
1108065274 13:46571225-46571247 GTGCGAGTCATCCAGCATGAGGG + Intronic
1111302789 13:86366821-86366843 ATGGTATCCATCCAGATTGAGGG + Intergenic
1112529139 13:100183521-100183543 GACGAAGTCATCCATTTTGATGG + Intronic
1113128957 13:107013316-107013338 GTGGTGCCCATCCAGATTGAGGG - Intergenic
1115931028 14:38494881-38494903 CTGGTAGTCTTACAGTTTCAGGG + Intergenic
1116408346 14:44593791-44593813 GAGGAGGTCATCCAGTTTGTGGG + Intergenic
1118714025 14:68546665-68546687 GTGGTATTCCTCCAGTTTTGGGG - Intronic
1119669633 14:76508650-76508672 GTGGTCTTCTTCCAGTTTGTTGG - Intergenic
1121191886 14:92038238-92038260 CTGGAAGACATCCAGGTTGAGGG + Intronic
1122678956 14:103441699-103441721 GAGGTAGGGATCCAGTTTCATGG + Intronic
1125423799 15:39530174-39530196 ATGGTACTCACCCAGATTGAAGG + Intergenic
1128847481 15:70913463-70913485 GGGGAAGTTATCCAGTTAGATGG + Intronic
1133693355 16:8237010-8237032 GTGCAATTCATCCAGGTTGAGGG - Intergenic
1138069991 16:53983378-53983400 CTGGTGGTCAGCCATTTTGACGG + Intronic
1144336054 17:14269888-14269910 CTGGTAGTCATACCTTTTGAGGG + Intergenic
1155839361 18:30627876-30627898 GTGGCAGTCATACATTTTAAAGG - Intergenic
1156727758 18:40149500-40149522 GTGGAAATCATCCAGTTAAAAGG - Intergenic
1156896577 18:42253593-42253615 GTGGTACACACCCAGATTGAGGG + Intergenic
1158760985 18:60386127-60386149 GTAGTAGTAATCCACTTTGAAGG - Intergenic
1160211347 18:76882852-76882874 GTGGTAGTCTTCCAGGTTACAGG + Intronic
926585668 2:14682924-14682946 ATGGTGCTCATCCAGATTGAGGG + Intergenic
928839296 2:35585698-35585720 GTGGTACTCATTCAGTCTGTTGG - Intergenic
929333925 2:40717086-40717108 ATGGTGCTCATCCAGATTGAGGG - Intergenic
930579102 2:53188199-53188221 GTGATAAGCATCCATTTTGAGGG + Intergenic
931790087 2:65657244-65657266 GTGGTATTCATCCAGTTTTCAGG - Intergenic
933038864 2:77434950-77434972 GACCTAGTCATCCAGTTTTAGGG + Intronic
944336460 2:198540916-198540938 ATGGTACTCACCCAGATTGAGGG - Intronic
945822160 2:214677530-214677552 AAGGTAGTCATCCAGATAGATGG - Intergenic
1170499230 20:16957556-16957578 ATGGTGCTCATCCAGATTGAGGG - Intergenic
1172356091 20:34281040-34281062 GCGGTAGTGATCCGGCTTGAAGG + Exonic
1174149521 20:48476286-48476308 GTGCTAGTCTTCAAGTTTGATGG - Intergenic
1174149589 20:48476685-48476707 GTGCTACTCTTCGAGTTTGAGGG - Intergenic
1174257632 20:49270006-49270028 CTGGGAGTCATCCAGCTTCAGGG + Exonic
1174972747 20:55295411-55295433 GTGGGAGTCATTCAATTTTAGGG + Intergenic
1177042934 21:16135067-16135089 ATGTTTGTCTTCCAGTTTGAAGG + Intergenic
1179084012 21:38201292-38201314 ATGGTACTCATCCAGATTAAGGG - Intronic
949417365 3:3829290-3829312 GTGGCAATCTTCCAGTTTCATGG + Intronic
950811797 3:15656314-15656336 GTGTGAGACATGCAGTTTGAGGG - Intergenic
951633648 3:24748831-24748853 GTGATAGTCTTCCAATTTTATGG - Intergenic
953424961 3:42787955-42787977 ATGGTAGTCATCCAGGAAGAAGG - Intronic
961726234 3:128932811-128932833 GTGGTAGTCCTCAAGATTGGGGG + Exonic
963612625 3:147490678-147490700 GTGATGGTGATGCAGTTTGATGG - Intronic
965206875 3:165730107-165730129 ATGGTACTCATCGAGATTGAGGG + Intergenic
965255749 3:166408502-166408524 ATGGAAGTCATCTAGTGTGAAGG + Intergenic
965540384 3:169865809-169865831 GTGGGAGTCATCCAGGTGGGTGG + Intronic
967440151 3:189498167-189498189 GTTGTAGTGATCCAGTTTAGAGG + Intergenic
970106073 4:12586034-12586056 GTGATGGTCATCCAGGTTCATGG - Intergenic
976043295 4:80913528-80913550 GTGCTAAGCATCCAGTTTGGTGG + Intronic
977001665 4:91512236-91512258 ATGGTACCCATCCAGATTGAGGG - Intronic
978394098 4:108259679-108259701 GTGGTAGTGTTCCATTTTGCTGG + Intergenic
978751548 4:112253752-112253774 GTGGTGGTCACCCTGTTTCATGG + Intronic
986083948 5:4424177-4424199 GTGATGGTCATCAAGTGTGAAGG + Intergenic
991247392 5:64522464-64522486 ATGGGAGTCACCCAGTTTGGAGG - Intronic
992162526 5:74016793-74016815 GTGGTGGGCAGCCAGATTGAGGG - Intergenic
997725088 5:136113693-136113715 GGGCTGGTGATCCAGTTTGAGGG + Intergenic
1005632094 6:27717754-27717776 GTGGTATAGATCCAGTTTGAAGG - Intergenic
1011543489 6:88458871-88458893 GTGGTAGTCATCAAATTGGAGGG + Intergenic
1011708461 6:90026969-90026991 GTGAAAGTCATCTAGCTTGAGGG + Intronic
1013097142 6:106955769-106955791 GTGTTAGTCAACCAGTTTATTGG - Intergenic
1015798225 6:137034172-137034194 GTGGTAGTCATCTAGTGGGTAGG - Intronic
1018600104 6:165529117-165529139 GTGGCAATCTTCCAGTTTAATGG - Intronic
1020953765 7:14713451-14713473 GTGTTTGACATCCAGTTTAATGG + Intronic
1021886216 7:25142292-25142314 ATGGTAATCATCCAGTTCAAGGG + Exonic
1031850506 7:126857452-126857474 ATGGAAGTGATCCAGTTTTAGGG - Intronic
1033161245 7:138999070-138999092 GTGGCATTTATCCAGTTTTATGG + Intergenic
1035002512 7:155624504-155624526 CTGGCACTCATCCAGTTTGTTGG + Intronic
1037157947 8:15728725-15728747 GGTGTTGTCATCCAGTTTCATGG - Intronic
1039260758 8:35768876-35768898 GCTATAGTCATCCAATTTGAGGG + Intronic
1040940767 8:52830559-52830581 GTGGTAGGCATCCTTTATGATGG + Intergenic
1045194530 8:99916895-99916917 AGGGAATTCATCCAGTTTGAAGG - Intergenic
1046329810 8:112699863-112699885 GAGGAACTCATCCAGATTGAAGG + Intronic
1050358389 9:4804568-4804590 GTTGAAGTCCTCCAGGTTGAAGG + Intronic
1051182468 9:14425683-14425705 GTGGCAATCCTGCAGTTTGAGGG - Intergenic
1052301831 9:26960914-26960936 ATGGAAGTCATCCAGGGTGATGG + Intronic
1055451701 9:76436793-76436815 GTGCTATCCATCCATTTTGAGGG - Intronic
1058355854 9:104082900-104082922 ATGGTACCCATCCAGATTGAGGG + Intergenic
1058932761 9:109737840-109737862 GCAGTTGCCATCCAGTTTGAAGG + Intronic
1062486367 9:136778470-136778492 CTGGTGTTGATCCAGTTTGAGGG - Intergenic
1062486412 9:136778666-136778688 CTGGTGTTGATCCAGTTTGAGGG - Intergenic
1062486424 9:136778715-136778737 CTGGTGTTGATCCAGTTTGAGGG - Intergenic
1062486435 9:136778764-136778786 CTGGTGTTGATCCAGTTTGAGGG - Intergenic
1062486543 9:136779256-136779278 CTGGTGTTGATCCAGTTTGAGGG - Intergenic
1187764553 X:22626109-22626131 TTGGAAGTCATTCAATTTGAAGG + Intergenic
1189731106 X:44022062-44022084 GATGGAGTCACCCAGTTTGAGGG + Intergenic
1190454699 X:50616324-50616346 GTGGTTGAAATCCAGTTTCAGGG - Intronic
1191652206 X:63551588-63551610 ATGGGAGTCATCAACTTTGAGGG + Intergenic
1194726830 X:97409050-97409072 GTAGTAGTAATCCAGGTTAAGGG + Intronic
1195365612 X:104122484-104122506 GTGGTATTCAGCCAGGGTGAAGG - Intronic
1199106061 X:143870068-143870090 ATGGAAGTCATACAGTTTCATGG + Intergenic
1199682781 X:150239145-150239167 GTGGGAGACATGCAGTTTGGAGG + Intergenic