ID: 924931152

View in Genome Browser
Species Human (GRCh38)
Location 1:248733446-248733468
Sequence CCATGACAACCCATAGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924931152_924931158 12 Left 924931152 1:248733446-248733468 CCTACCTCTATGGGTTGTCATGG 0: 1
1: 0
2: 2
3: 18
4: 192
Right 924931158 1:248733481-248733503 GCCAAAGCCCGTTACTCAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 57
924931152_924931156 -10 Left 924931152 1:248733446-248733468 CCTACCTCTATGGGTTGTCATGG 0: 1
1: 0
2: 2
3: 18
4: 192
Right 924931156 1:248733459-248733481 GTTGTCATGGGAATAAAATATGG 0: 1
1: 0
2: 1
3: 35
4: 279
924931152_924931157 11 Left 924931152 1:248733446-248733468 CCTACCTCTATGGGTTGTCATGG 0: 1
1: 0
2: 2
3: 18
4: 192
Right 924931157 1:248733480-248733502 GGCCAAAGCCCGTTACTCAAAGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924931152 Original CRISPR CCATGACAACCCATAGAGGT AGG (reversed) Intronic
900772856 1:4559516-4559538 CCAGGAAAACCTATGGAGGTGGG - Intergenic
904259077 1:29277679-29277701 CCATGACAACCCTATGTGGTAGG + Intronic
904379102 1:30099486-30099508 CCATGACAACCCTGGGAAGTAGG + Intergenic
906037032 1:42757182-42757204 CAATGACAACCCACACAGGAGGG + Intronic
906630455 1:47362934-47362956 CCAGTCCCACCCATAGAGGTTGG - Intronic
907250324 1:53133869-53133891 TCATGACAACCCTTCGAAGTAGG + Intronic
908138627 1:61159633-61159655 TCATAACAACCCAATGAGGTAGG - Intronic
909945680 1:81660364-81660386 CCAAGACAACTCACTGAGGTTGG + Intronic
910452650 1:87362738-87362760 CCATAACAACCCAATGAGGCAGG - Intergenic
910699269 1:90055164-90055186 TCATGACAACCCTATGAGGTAGG + Intergenic
912322085 1:108723204-108723226 TCATGACAACTCAGTGAGGTGGG + Intronic
915020898 1:152777548-152777570 CCATGAGAACCCAACAAGGTTGG + Intronic
915626920 1:157119544-157119566 TCATGACAACCCTTTGAGGTAGG - Intergenic
916582923 1:166124454-166124476 CCATAACAACCCTATGAGGTGGG + Intronic
917610598 1:176685268-176685290 TCATGACAATCCTTTGAGGTAGG + Intronic
917966995 1:180185202-180185224 CCATGACAACCTCCTGAGGTTGG - Intronic
919941740 1:202291773-202291795 CCATGCCAACCCTTTGAGGTAGG - Intronic
920313139 1:205060087-205060109 TCATGACAACCCTATGAGGTAGG - Intronic
921073223 1:211679147-211679169 ACATGACAAACCCTAAAGGTTGG + Intergenic
921260382 1:213381012-213381034 TCATGACAACTCGTAGAGCTTGG + Intergenic
924364746 1:243280108-243280130 CCATGAAAACTCACAGAGGGAGG - Intronic
924931152 1:248733446-248733468 CCATGACAACCCATAGAGGTAGG - Intronic
1063002437 10:1937050-1937072 CCATGATGACACATGGAGGTGGG - Intergenic
1064484933 10:15776617-15776639 ACATGACAACCCATAGAGTGGGG - Intergenic
1065271889 10:24041607-24041629 CTATGGCAGCCCAAAGAGGTTGG + Intronic
1066090798 10:32017050-32017072 CCATGACAACACATAAAATTCGG + Intronic
1067999738 10:51318342-51318364 TCATGATAACCCATTGAAGTAGG - Intronic
1068395351 10:56454756-56454778 GCATTACAACCCACAGAGATAGG + Intergenic
1071130686 10:82390075-82390097 CCATAAAAACGCATTGAGGTAGG - Intronic
1073405779 10:103296551-103296573 TCATGACAACCCCTTGAGTTAGG + Intergenic
1074000009 10:109362360-109362382 TCATAACAACCCAAAGAGGTAGG + Intergenic
1074236682 10:111591667-111591689 CCATGACATCCCAAAGTGCTAGG + Intergenic
1074813621 10:117128165-117128187 CCATGACAATCCTATGAGGTAGG + Intergenic
1078289240 11:9990409-9990431 CCATAACACCCCATTGTGGTAGG + Intronic
1080752783 11:35166231-35166253 CCATGGCAACACACAGGGGTGGG + Intronic
1082762706 11:57142943-57142965 CCATGACAGCCCCATGAGGTGGG + Intergenic
1083175108 11:60944755-60944777 CCATGACAAGGCATAGAGAGTGG + Intronic
1084063977 11:66692965-66692987 CCACGAGCACCCAGAGAGGTGGG - Exonic
1085808914 11:79662533-79662555 TCAGTACAACCCAGAGAGGTAGG + Intergenic
1087761252 11:102106366-102106388 CCTTGGCAACCCAAAGTGGTGGG + Intergenic
1087822490 11:102728236-102728258 TCATAACAACCCAGAGAAGTGGG + Intergenic
1088555741 11:111058939-111058961 CCATGAGACCCAATAGGGGTGGG - Intergenic
1088744661 11:112795461-112795483 CCATAACAACCCATTCAGGTTGG - Intergenic
1088756677 11:112890785-112890807 CCATCACTAACAATAGAGGTAGG - Intergenic
1088920177 11:114254864-114254886 GCAGGACAAACCAGAGAGGTTGG + Intergenic
1091083072 11:132691081-132691103 CCATGACAACCCTATGAAGTAGG + Intronic
1094436540 12:30426471-30426493 CTCTGACAACCTATAGAGCTAGG + Intergenic
1095937157 12:47697317-47697339 CCATAAGAACCCGTTGAGGTTGG + Intronic
1097297802 12:57985742-57985764 TCATGACAACCCTGTGAGGTAGG + Intergenic
1100521150 12:95377230-95377252 CCATGCCTACCCAAAGTGGTAGG - Exonic
1101034362 12:100690372-100690394 ACATGACAATCCTTTGAGGTAGG + Intergenic
1101836376 12:108298674-108298696 TCATCACAGCCCATAGAGGCAGG + Intronic
1103441577 12:120966775-120966797 CCACAACAACCCAATGAGGTAGG - Intergenic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1108496765 13:51033242-51033264 CCATGACAACCCTGAAAGGGTGG + Intergenic
1110552377 13:76824127-76824149 TCATGACAGCCCAGGGAGGTAGG - Intergenic
1112377442 13:98856427-98856449 CCATGACACCCCTCAGAGTTGGG - Intronic
1113959083 13:114115727-114115749 CCTTGAGAAGCAATAGAGGTAGG - Intronic
1115201344 14:30857240-30857262 CCATGACAACTCTGTGAGGTTGG + Intergenic
1117647974 14:57872479-57872501 CAATGACAATCCATACAGGGTGG - Intronic
1118630439 14:67697562-67697584 CCATAACAACTCTAAGAGGTAGG + Intergenic
1121091132 14:91183530-91183552 GCATCACAACCCAGAGAGGCAGG - Intronic
1121361701 14:93267391-93267413 CCATAACAACCCTGTGAGGTAGG - Intronic
1121873281 14:97428825-97428847 TCTTGACAACCCTTAGAAGTGGG + Intergenic
1128608100 15:69053294-69053316 CCATGACAATCCTATGAGGTGGG - Intronic
1130272415 15:82458920-82458942 CCCAGCCAACCCATGGAGGTGGG + Intergenic
1130464766 15:84186273-84186295 CCCAGCCAACCCATGGAGGTGGG + Intergenic
1130487919 15:84408531-84408553 CCCAGCCAACCCATGGAGGTGGG - Intergenic
1130499500 15:84487264-84487286 CCCAGCCAACCCATGGAGGTGGG - Intergenic
1130587058 15:85190887-85190909 CCCAGCCAACCCATGGAGGTGGG + Intergenic
1130985341 15:88841268-88841290 TCATGTCAACCCAGTGAGGTAGG - Intronic
1133321383 16:4915759-4915781 TCATGACAACCCTGAGAGCTGGG + Intronic
1133337913 16:5018126-5018148 CCACTACAACCTATTGAGGTAGG - Exonic
1135635164 16:24069490-24069512 CCATGGCCTCCCAAAGAGGTGGG - Intronic
1135651246 16:24208650-24208672 CCAAGACAAGCCAGAGAGGCAGG + Intronic
1135849549 16:25950807-25950829 TCATGACAACCCCCGGAGGTGGG - Intronic
1137555330 16:49466915-49466937 CCATGACAACCCACCAAAGTGGG - Intergenic
1139541482 16:67620800-67620822 ACATGAGAACCCATTCAGGTAGG + Exonic
1144534046 17:16069679-16069701 TCATAACAATCCAGAGAGGTAGG + Intronic
1145778061 17:27543314-27543336 CCATGACACACCATGGAGGATGG + Intronic
1146360476 17:32171839-32171861 CCATAACAATCCTTTGAGGTAGG - Intronic
1146515932 17:33489288-33489310 TCATGAAAACCCAAAGGGGTGGG + Intronic
1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG + Intergenic
1150343847 17:64389036-64389058 CCATGGCAACCCACGGAGGCAGG - Intronic
1151396388 17:73825989-73826011 CCATGGTAACCCTAAGAGGTAGG + Intergenic
1152356024 17:79807805-79807827 TCATCACAACCCTTAGAGGGAGG + Intergenic
1158364075 18:56710805-56710827 TCATAACAACCCTTCGAGGTAGG - Intronic
1158620194 18:59026335-59026357 TCATGACAACCCTACGAGGTAGG + Intergenic
1158684721 18:59602984-59603006 CCATGACAGCCCTCGGAGGTTGG - Intronic
1159826119 18:73212969-73212991 TCATGTCAACCCAAAGAGGATGG + Intronic
1160279999 18:77480357-77480379 CAATGAGAACACATAGACGTAGG - Intergenic
1161200666 19:3013008-3013030 CCATGGCAACCGCCAGAGGTTGG - Intronic
1161741807 19:6025605-6025627 CTATGACAACCCGAGGAGGTAGG + Intronic
1163206850 19:15809638-15809660 CCACAACAACCCTTTGAGGTAGG - Intergenic
1164478867 19:28596212-28596234 CCATGACAACTGAAAGAGGGAGG + Intergenic
925128517 2:1478021-1478043 CCAGAACAACCCTTGGAGGTGGG + Intronic
926183489 2:10667713-10667735 CCATAACAACCCCCCGAGGTAGG - Intronic
926728205 2:16014825-16014847 CCATGCCAACCTGAAGAGGTTGG - Intergenic
930004747 2:46887795-46887817 CCATAACAACCCAATGAAGTAGG + Intergenic
930569183 2:53063211-53063233 CCAAGACAGCCCTTTGAGGTGGG + Intergenic
932875248 2:75444438-75444460 CCATGACAACCCTATGAGGTGGG + Intergenic
937927248 2:127176726-127176748 CCAGGACAACTCCAAGAGGTCGG + Intergenic
938230069 2:129650686-129650708 CCAAGCCCACCCATAGAGGCAGG - Intergenic
938926700 2:136049669-136049691 CCATGACCACCTATAGTGGAAGG - Intergenic
941848962 2:170159771-170159793 TCATGACACCCCTTTGAGGTAGG - Intergenic
943335765 2:186611738-186611760 ACATGGCAACCCTGAGAGGTAGG - Intronic
944881765 2:204020010-204020032 CCATGACAACCCTCCGAGTTAGG + Intergenic
945407419 2:209466703-209466725 CCATGAAAACCCTTAAAGATAGG + Intronic
946145130 2:217724888-217724910 TCATGGCAACCCAGTGAGGTAGG - Intronic
947744601 2:232501066-232501088 CCATGACAGCCCTGAGAGGTTGG - Intergenic
947825454 2:233103244-233103266 GAATGACAACCCATATAGGTGGG + Intronic
948133070 2:235615150-235615172 CTATGACAACCCACAGAGGTGGG + Intronic
1170577070 20:17672115-17672137 CACTGCCAACCCCTAGAGGTGGG + Intronic
1171009783 20:21502839-21502861 CCATGAGAAGCCAGAGAGATGGG + Intergenic
1172694171 20:36810255-36810277 TCATGACGACCCTCAGAGGTGGG - Intronic
1173139247 20:40467772-40467794 TCATGACAATCCAGTGAGGTAGG + Intergenic
1173597303 20:44267210-44267232 CCATAACAACCCCAGGAGGTGGG + Intronic
1173840311 20:46152712-46152734 TCATAACAACCCAAAGAGGAAGG + Intergenic
1174273865 20:49389305-49389327 ACATGACAACCCAGTGAGGGAGG - Intronic
1175914367 20:62418905-62418927 CCTAGGCAACCCAGAGAGGTGGG - Intronic
1181966891 22:26662978-26663000 TCATGACAACCCTGTGAGGTGGG + Intergenic
1182071749 22:27468682-27468704 CCAAGACAACCCTTTGAGGTAGG + Intergenic
1182411098 22:30187235-30187257 CCATAACAACCCTTTGAGATAGG + Intergenic
1182418034 22:30233738-30233760 CCATGACATCCCAAAGTGCTGGG - Intergenic
1182619348 22:31610328-31610350 CCACGACAACCCCAAGAGGTAGG - Intronic
1182779393 22:32855586-32855608 CCATGACAACCCTATGAGGTAGG - Intronic
1182837015 22:33350504-33350526 CCATGCCAACCTCTAGAGGTGGG - Intronic
1184102056 22:42345853-42345875 CCATAAAAGCCCATAGAGGCTGG - Intergenic
1184154413 22:42657799-42657821 GCACAATAACCCATAGAGGTGGG - Intergenic
951392428 3:22123004-22123026 CCATGACAACCCATTGCATTTGG - Intronic
952412338 3:33060847-33060869 TCATGATAACCCATCGAGTTAGG - Intronic
953912543 3:46900215-46900237 CCATGACAAGCCCCAGAGTTGGG + Intronic
956161069 3:66353077-66353099 CACAGACAACCCAGAGAGGTGGG + Intronic
957367576 3:79246259-79246281 TCATGACAACCCCAGGAGGTAGG + Intronic
958740025 3:98057869-98057891 CCATCACAACACATAGAGGGAGG - Intergenic
961033656 3:123627437-123627459 CCATTACAACTCAAAGAAGTAGG + Intronic
965843987 3:172939989-172940011 CCATAAAAACCCATAAAAGTTGG + Intronic
966829862 3:183998534-183998556 TCATAACAACCCTTTGAGGTAGG + Intronic
967189316 3:186972082-186972104 CCATGACAACCCTAAGAATTGGG + Intronic
967987575 3:195106871-195106893 CCAAAACACCCCCTAGAGGTGGG + Intronic
968310908 3:197682410-197682432 CCCTGACAATCCAAAGAGGACGG + Intronic
970006056 4:11411964-11411986 CCATGACAATCCCATGAGGTTGG - Intronic
972016232 4:34249503-34249525 CAATGAGAACACATAGATGTAGG - Intergenic
976623771 4:87156354-87156376 CCTGGACAACACAGAGAGGTGGG + Intergenic
980413639 4:132457276-132457298 TTATGACAACCCTTTGAGGTAGG - Intergenic
981163059 4:141522086-141522108 CCACGTCAACCCATGGTGGTTGG + Intergenic
984270667 4:177545222-177545244 CCATGAAAACAAACAGAGGTAGG + Intergenic
988803754 5:34721021-34721043 CCATGACAGCCCACAGAGAGGGG + Intronic
989114779 5:37941986-37942008 TCATGACAACCCAGTGAGGTAGG + Intergenic
989414859 5:41162126-41162148 TCATGACAACCCTGAGAAGTAGG + Intronic
991631836 5:68664404-68664426 CCATGTAAATCCGTAGAGGTGGG - Intergenic
997883224 5:137609186-137609208 CCATGACAATCCTAAGAGGCAGG - Intergenic
998655590 5:144175188-144175210 TCCTGACAACCCAATGAGGTAGG + Intronic
999576277 5:152981499-152981521 TCATGACAACCCTGAGAGTTAGG - Intergenic
1000231698 5:159321564-159321586 CCATGACAAAACATATGGGTTGG + Intronic
1000460842 5:161516322-161516344 TCATAACAACCCCAAGAGGTAGG + Intronic
1002126900 5:177052431-177052453 CCATGACCTCCCAAAGTGGTGGG + Intronic
1006403571 6:33831537-33831559 CCCTGCCCACCCATAGAGCTGGG + Intergenic
1006682602 6:35807901-35807923 CCAGCACAACCCATTGAGGTGGG + Intronic
1006717034 6:36127211-36127233 TCACGACAACCCAATGAGGTAGG - Intergenic
1012837684 6:104291100-104291122 TCACAACAACCCTTAGAGGTAGG - Intergenic
1015074258 6:129135379-129135401 CCATCACTACCCACAGAGGAAGG - Intronic
1015324934 6:131914268-131914290 CTATGTCATCCCATAGAGGAAGG + Intergenic
1015607923 6:134979319-134979341 CCATAACAACCAACAGAGTTTGG + Intronic
1016550937 6:145279186-145279208 ACATAATAACCCATAGAGATGGG - Intergenic
1018080280 6:160253571-160253593 CCATCACAACACATAAAAGTAGG + Intronic
1018410661 6:163543549-163543571 CCATGGCAACTCATTTAGGTTGG - Intronic
1019060210 6:169252047-169252069 TCATGACAACCCGATGAGGTGGG - Intronic
1022613965 7:31909522-31909544 GCATGACATCTCATAGAGTTTGG - Intronic
1023219707 7:37907279-37907301 CCATCACAAGCCATAGTGGTAGG - Exonic
1029100367 7:98124829-98124851 CCATAACAACTCTTTGAGGTAGG - Intronic
1029350245 7:100008305-100008327 TCATGACATCCCAATGAGGTAGG + Intergenic
1030018024 7:105244171-105244193 CCATGAGAACACAGAGAAGTTGG + Intronic
1030827981 7:114185437-114185459 CCATAACAACCCTTTGAGATAGG - Intronic
1031625074 7:123983421-123983443 CCATGCCAGCACATAGGGGTAGG - Intergenic
1031763708 7:125747421-125747443 CCATGGAAGCCCAGAGAGGTTGG + Intergenic
1032863312 7:135902194-135902216 CCAGGACAGCCCAAAGAGGGAGG + Intergenic
1033972481 7:147059088-147059110 TTATGACAACCCTAAGAGGTAGG - Intronic
1034162667 7:149004532-149004554 CCAGGACAACCCACAGACATCGG + Intronic
1038809393 8:30824763-30824785 CCATAACAACCCTAAGAAGTAGG + Intergenic
1041600476 8:59711655-59711677 TCATGACAACCCAGAGTGATTGG + Intergenic
1042792465 8:72623745-72623767 TCATGACAACCACTACAGGTAGG + Intronic
1043206452 8:77449747-77449769 CCATGGCCACCCAAAGAGCTGGG - Intergenic
1043418049 8:80071627-80071649 CCATGACGTCTCAGAGAGGTAGG - Intronic
1044372704 8:91431920-91431942 CCATGATAAAGCATAAAGGTAGG - Intergenic
1044562300 8:93625021-93625043 GCATGACAAGGCATACAGGTAGG - Intergenic
1045662186 8:104449510-104449532 CCAAGTCAACCCATAGCAGTAGG - Intronic
1046030049 8:108772882-108772904 CCATGACAATCCTGTGAGGTAGG - Intronic
1046658332 8:116921889-116921911 CCATAATAACCCTCAGAGGTTGG + Intergenic
1048056122 8:130867370-130867392 CCATGACAACCTTATGAGGTAGG - Intronic
1050789109 9:9443624-9443646 CCATGAGAACACATAGAGAAGGG + Intronic
1052745578 9:32437204-32437226 TCATAACAACCCCTTGAGGTAGG + Intronic
1053180006 9:35960709-35960731 CCACGACAACCCTCAGAGCTGGG - Intergenic
1055540311 9:77297757-77297779 CCACAACAACCCAATGAGGTAGG - Intronic
1056543725 9:87595783-87595805 CCAGAACAACACACAGAGGTAGG - Intronic
1058153851 9:101490018-101490040 TCATGACCAACCATAGAAGTAGG - Intronic
1058888797 9:109343375-109343397 CCATGAAAAACCATAGAGGAGGG + Intergenic
1059921034 9:119160003-119160025 TCATGGCAACCCAGTGAGGTGGG - Intronic
1060165324 9:121409044-121409066 GCATGACAACTCAAACAGGTAGG - Intergenic
1061792243 9:133064858-133064880 CCATGAAATCCCACAGAGGCGGG + Intronic
1186499746 X:10041772-10041794 CCATGCCAAGGCACAGAGGTGGG - Intronic
1187298259 X:18023678-18023700 CCGTCACAGCCCATAGAGGTTGG + Intergenic
1187444024 X:19344696-19344718 TCAAGACAACCCCAAGAGGTGGG - Intronic
1190737519 X:53265448-53265470 TCATGACAACCCAGAGAGGTAGG + Intronic
1192247547 X:69386349-69386371 CCATGACAACCATATGAGGTAGG - Intergenic
1192584682 X:72309592-72309614 CCAGGACAGCCCTTTGAGGTAGG + Intergenic
1193386304 X:80875683-80875705 CTATAACAACCCTTAGAAGTTGG + Intergenic
1193734454 X:85140351-85140373 CCATAACAACCCTAAGAGGGTGG + Intergenic
1195227832 X:102816770-102816792 CTATGTCAACCCATGGTGGTTGG + Intergenic
1196149274 X:112354360-112354382 TCATGACAACCCAATGAGGAAGG - Intergenic
1198491659 X:137147354-137147376 CCAAGATTTCCCATAGAGGTGGG + Intergenic
1199016758 X:142826158-142826180 CCATGACAACCCAATAAAGTAGG - Intergenic
1199530320 X:148839432-148839454 CCACTACAACCCAAAGAGATTGG + Intronic