ID: 924932716

View in Genome Browser
Species Human (GRCh38)
Location 1:248745047-248745069
Sequence GGGTTAACACAGAAGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924932716_924932722 28 Left 924932716 1:248745047-248745069 CCCTGGTCCTTCTGTGTTAACCC 0: 1
1: 0
2: 1
3: 9
4: 124
Right 924932722 1:248745098-248745120 TTCCAGCCCAAGTCCCATAGAGG 0: 1
1: 0
2: 2
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924932716 Original CRISPR GGGTTAACACAGAAGGACCA GGG (reversed) Intronic
904334349 1:29787284-29787306 AGGTGGACACAGAAGGACCCTGG - Intergenic
905890173 1:41513755-41513777 GGGCAAACACAGAAGACCCAAGG + Intronic
907090948 1:51724842-51724864 GGGCTAACACAGAAGGGTAAAGG - Intronic
908193362 1:61725537-61725559 GGGTTTACAGATAAGGAACAAGG + Intergenic
910603756 1:89060071-89060093 GGGTTAACACAGATGCATAAAGG - Intronic
910637071 1:89420422-89420444 GGGTTAACACAGATGCATAAAGG + Intergenic
915061502 1:153189751-153189773 GGGGTAGTACAGAAGGTCCAGGG + Intergenic
916316643 1:163455722-163455744 GTTTTAAAACAGAAGAACCAGGG + Intergenic
916826158 1:168443988-168444010 GGATTAACACAGAAGAATAAAGG + Intergenic
920388885 1:205586547-205586569 AGGTAAACACAGGAGGACCAGGG - Intronic
922851411 1:228736189-228736211 GAGCTAACACGAAAGGACCACGG + Intronic
924932716 1:248745047-248745069 GGGTTAACACAGAAGGACCAGGG - Intronic
1064225589 10:13481595-13481617 GGGCTAACCCAGAAGGCCCCTGG + Intronic
1069314992 10:67087240-67087262 AGGTTAACACAGAAGGGTCCAGG + Intronic
1069815469 10:71191180-71191202 GGGTTAACAGAGGCGGCCCAGGG + Intergenic
1072619451 10:97069945-97069967 GGGCAAACCCAGAAGGAACAAGG - Intronic
1073689860 10:105796448-105796470 GTGTTAGCACAGAAACACCAAGG + Intergenic
1074127519 10:110541045-110541067 GTGTTAACACAGATGGCCAAAGG - Intergenic
1074187167 10:111107228-111107250 GGGTCAGCAGAGAATGACCATGG - Intergenic
1074385544 10:113014066-113014088 GAGTTAACACAGGAGGACAGGGG + Intronic
1074903425 10:117839337-117839359 GGTTTACCACAGAATGGCCAGGG - Intergenic
1084196351 11:67525160-67525182 GGGCTAGCACAGAGGGACCCTGG - Intergenic
1084196368 11:67525203-67525225 GGGCTAGCACAGAGGGACCCTGG - Intergenic
1095451859 12:42339472-42339494 GGTGTAACACAGAAGGCACAGGG - Intronic
1097597501 12:61652605-61652627 GGGTTGACAGAGCAGGCCCAGGG + Intergenic
1100637442 12:96448389-96448411 GCGTCAACACATAAGGAACAGGG - Intergenic
1101997785 12:109537370-109537392 GGGTCAGGACAGAAGCACCAAGG - Intergenic
1103798224 12:123519792-123519814 GGGTTAGCTCAGGAGGAGCACGG - Intronic
1110763730 13:79258696-79258718 GGCTTAACACAGAAGCGGCAGGG - Intergenic
1115487384 14:33925067-33925089 TGGTTAACACAAAACTACCAGGG + Exonic
1118230217 14:63940723-63940745 GGGTCAAAACAGAAGGAGTAGGG - Intronic
1120967505 14:90180818-90180840 AGGCCAACACAGAAGCACCATGG - Intronic
1128335837 15:66785278-66785300 GAGTTCAGACAGAAGGGCCAAGG - Intergenic
1129271022 15:74419302-74419324 GGGCTAAGGCAGGAGGACCAGGG + Intronic
1131224305 15:90611289-90611311 GGGAGCACACAGAAGGAACATGG + Intronic
1132106509 15:99066700-99066722 GGGTTAAAAAGAAAGGACCAAGG + Intergenic
1132769115 16:1551258-1551280 GGGTAAAGACACAATGACCACGG + Intronic
1135882553 16:26272653-26272675 GGTTTAACACAGAAAGAAGAAGG - Intergenic
1142707667 17:1706845-1706867 GGCTAGACACAGCAGGACCAGGG + Exonic
1146373365 17:32279180-32279202 GGACTAACACAGAAAAACCAGGG + Intronic
1147129527 17:38398749-38398771 GGGTTGACACAGAAACACAAAGG - Intronic
1148382318 17:47209100-47209122 GTGGAAACCCAGAAGGACCAGGG - Exonic
1150139034 17:62713173-62713195 AGGTAAACAAATAAGGACCAAGG - Intronic
1150420416 17:65029053-65029075 TGGTGAACACTGAAGGATCAAGG + Intronic
1152424687 17:80212511-80212533 GGGGTGACACAGAAGTGCCAAGG - Intronic
1156860736 18:41833468-41833490 TGGTTAACAGAGAGGGAACATGG - Intergenic
1158693015 18:59678270-59678292 TGGTGAGGACAGAAGGACCAGGG + Intronic
1163033780 19:14560454-14560476 GGGTTAGCACAGCAGGGCCCTGG - Intronic
1163197438 19:15732936-15732958 GGGCAAACACAGAAGGCCCCAGG - Intergenic
1163493127 19:17628683-17628705 CGGTTAACACAGATGAAACATGG + Intronic
1168096445 19:54118164-54118186 GGGTTGATAAAGAAGGACCAGGG + Intronic
1168490362 19:56803806-56803828 GGGTTAAAAGAGCAGGACCCAGG - Intronic
925014091 2:508619-508641 GGGTTCACACAGAGAGACCCAGG + Intergenic
925044699 2:763965-763987 GGGTTTTCCCAGAAGGACCTTGG + Intergenic
929226297 2:39514826-39514848 TGGTCCAAACAGAAGGACCAGGG - Intergenic
929612400 2:43281032-43281054 GGGTTATCACTGGAGGGCCATGG + Intronic
931989033 2:67770935-67770957 GGGTCAATACAGAAGGCCTATGG + Intergenic
934495720 2:94795653-94795675 GTGTTAACACAGAAAGAAAATGG - Intergenic
938809303 2:134837562-134837584 GGGTAAACACAGAACAATCAAGG + Intergenic
940801398 2:158136950-158136972 TGGGTAAGACTGAAGGACCAAGG - Intergenic
942885001 2:180912414-180912436 GGATTGACACAGAAGAGCCAAGG + Intergenic
948305010 2:236940254-236940276 GGGAGCCCACAGAAGGACCAGGG + Intergenic
1169474120 20:5915667-5915689 GGGTAGGCAGAGAAGGACCAAGG + Intronic
1169719163 20:8654390-8654412 GGATTAAAACAGAAGACCCAAGG + Intronic
1175622920 20:60465909-60465931 TGGTAAACAAAGAAGGACCAAGG - Intergenic
1176003757 20:62848036-62848058 GAGTTCTCACAGAAGGATCACGG + Intronic
1179393378 21:41014417-41014439 GGATTAAAACAGAAAGAGCATGG + Intergenic
1180933052 22:19606278-19606300 GGGCCGACACAGAAGGGCCAGGG + Intergenic
1181083824 22:20430162-20430184 GAGTTGGTACAGAAGGACCAGGG - Intronic
1182723399 22:32422926-32422948 TTTTTAACACAGAAGGACAATGG - Intronic
1182941764 22:34283736-34283758 GGGTGAACACAGAAACAGCATGG - Intergenic
1183032070 22:35113841-35113863 GAGGAAGCACAGAAGGACCAGGG - Intergenic
1183212168 22:36457872-36457894 GAGTTGACAGAGAAGGTCCAGGG - Intergenic
1183897796 22:40983109-40983131 AGGGTAACCCAGAAGGGCCACGG - Intergenic
1184123813 22:42472603-42472625 GGGTTAACACAGTGGTAGCAAGG + Intergenic
949742984 3:7257809-7257831 GGAATATCTCAGAAGGACCAAGG - Intronic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
952117677 3:30202178-30202200 GGGTTAACGGAGAAGGACTATGG - Intergenic
952373775 3:32748025-32748047 TGGTTAACACAGTGGGACCCTGG - Intronic
955213117 3:56960610-56960632 GGGCTGACACAGAAGAGCCAGGG + Intronic
957054021 3:75430733-75430755 GGGTTTGCAAAGAAGGCCCAGGG + Intergenic
957408665 3:79807610-79807632 GGGGTAACACAAAGGAACCATGG - Intergenic
960967819 3:123117086-123117108 GGGGGAACACAGAGGTACCAGGG - Intronic
962647358 3:137453702-137453724 GGGTGAAGTCAGAAGGACAAAGG - Intergenic
966620615 3:181959538-181959560 GGCTGAAATCAGAAGGACCATGG + Intergenic
969684452 4:8662933-8662955 GGATCCACGCAGAAGGACCAGGG + Intergenic
970140271 4:12974605-12974627 GCTCTAACCCAGAAGGACCAAGG + Intergenic
970705548 4:18797319-18797341 GGAATAAAACAGAAGGACCATGG + Intergenic
971269678 4:25129673-25129695 GGGTTAAGAAAGAGGGACCAGGG - Intronic
971347770 4:25827050-25827072 GTGTAAACATAGAAGGATCAAGG - Intronic
972215545 4:36893892-36893914 GGGATAAGACAGAAGGAAGAGGG - Intergenic
974436254 4:61861134-61861156 GGATTACCAGGGAAGGACCAGGG + Intronic
978385177 4:108170898-108170920 GGGAGAACACAGAATGGCCAGGG + Intergenic
979478601 4:121187533-121187555 TTGTTAATAAAGAAGGACCATGG + Intronic
982589841 4:157294020-157294042 GGGTTAACACATAAGTACTATGG + Intronic
983287206 4:165754821-165754843 GGGCTAACAAAGAAGCACCATGG + Intergenic
985882842 5:2653568-2653590 GGTTAGACACAGAAGGAGCATGG - Intergenic
986794731 5:11198549-11198571 GAGTTAAGACAGAAGGTCGACGG + Intronic
988548558 5:32179588-32179610 GGGTTAAAACAGAAAGACTCTGG - Intergenic
990181417 5:53164696-53164718 TGGTAAAAACAGAAGGACAAAGG + Intergenic
993289184 5:86042485-86042507 AAGTTAACACAGAAGGGCAAAGG - Intergenic
998190675 5:140021641-140021663 GAGTTCAGACAGAAGGGCCATGG + Intronic
998556038 5:143124636-143124658 GGGCAAACACAGAAGCAGCAAGG + Intronic
1002113236 5:176935804-176935826 GAGTTAACAGAGAAGGACCAAGG - Intronic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1017593485 6:156002964-156002986 TGGATAACACAGAAGTACAAAGG - Intergenic
1019217404 6:170452592-170452614 GGGTGCACCCAGCAGGACCAGGG + Intergenic
1020343542 7:7138538-7138560 GGAATAGCACAGAAGGAGCAGGG + Intergenic
1025109621 7:56203156-56203178 GAGTTAACAGAGAGGCACCATGG + Intergenic
1027824679 7:83095661-83095683 GAGTTAACAAAAAAGGCCCAAGG - Intronic
1029895187 7:103976255-103976277 GGGAAAACAGAGAAAGACCAGGG + Intronic
1031907539 7:127477257-127477279 GGATTAAAACAGAAGGAATAAGG + Intergenic
1034104497 7:148478649-148478671 GGGCTAACCCAGAAGAGCCAGGG - Intergenic
1039010282 8:33086184-33086206 GGGTTCACACAGAGAAACCAAGG + Intergenic
1040579544 8:48686263-48686285 GGGTTGACACAGAAGGTAGAGGG - Intergenic
1041304543 8:56446300-56446322 GGGGTCACAAAGAAGAACCAGGG + Intronic
1045651790 8:104348220-104348242 GACTTAACACAGCAGGAGCAGGG + Intronic
1049469840 8:142770395-142770417 GGGAGAACACAGAGGGAGCATGG + Intronic
1053582634 9:39422815-39422837 AGAATAACACACAAGGACCAAGG - Intergenic
1053846816 9:42247660-42247682 AGAATAACACACAAGGACCAAGG - Intergenic
1054104213 9:60981558-60981580 AGAATAACACACAAGGACCAAGG - Intergenic
1054582131 9:66925292-66925314 AGAATAACACACAAGGACCAAGG + Intronic
1059419880 9:114184223-114184245 GGGTTATCAAAGAATGACCCGGG - Intronic
1060963010 9:127694527-127694549 TGGGTAACACAGGAGGACCAGGG - Intronic
1061363448 9:130158000-130158022 GGGTCGACACAGCAGGAACAAGG - Intergenic
1062206383 9:135339777-135339799 GGGTGAACACATAGGGACCCGGG - Intergenic
1187124924 X:16446052-16446074 TGGTTCACACAGAAGTCCCACGG - Intergenic
1187402766 X:18976324-18976346 GCTTTTACAGAGAAGGACCAAGG - Intronic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1190322950 X:49189011-49189033 GGGTAAACAGAGAGGGGCCAAGG + Exonic
1190584274 X:51922536-51922558 GTGTCAACACTGCAGGACCAAGG - Intergenic
1194591185 X:95801877-95801899 GGGTCAACACCGAAGGGTCAAGG + Intergenic
1194765442 X:97842821-97842843 GGGTTGGCAGAGAAGGACCCAGG - Intergenic
1200254252 X:154571161-154571183 GGGATAACACAGAAAACCCATGG + Intergenic
1200263517 X:154633247-154633269 GGGATAACACAGAAAACCCATGG - Intergenic