ID: 924937840

View in Genome Browser
Species Human (GRCh38)
Location 1:248787392-248787414
Sequence GATGGGACAGTGGCCAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937840_924937852 29 Left 924937840 1:248787392-248787414 CCATCCCTGGCCACTGTCCCATC No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937840_924937851 28 Left 924937840 1:248787392-248787414 CCATCCCTGGCCACTGTCCCATC No data
Right 924937851 1:248787443-248787465 GTGTGCTCTTGTATCCATGCAGG No data
924937840_924937849 4 Left 924937840 1:248787392-248787414 CCATCCCTGGCCACTGTCCCATC No data
Right 924937849 1:248787419-248787441 CAGTTCTGAGATGAATATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937840 Original CRISPR GATGGGACAGTGGCCAGGGA TGG (reversed) Intergenic
No off target data available for this crispr