ID: 924937841

View in Genome Browser
Species Human (GRCh38)
Location 1:248787396-248787418
Sequence GGGAGATGGGACAGTGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937841_924937851 24 Left 924937841 1:248787396-248787418 CCCTGGCCACTGTCCCATCTCCC No data
Right 924937851 1:248787443-248787465 GTGTGCTCTTGTATCCATGCAGG No data
924937841_924937852 25 Left 924937841 1:248787396-248787418 CCCTGGCCACTGTCCCATCTCCC No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937841_924937849 0 Left 924937841 1:248787396-248787418 CCCTGGCCACTGTCCCATCTCCC No data
Right 924937849 1:248787419-248787441 CAGTTCTGAGATGAATATCCAGG No data
924937841_924937853 30 Left 924937841 1:248787396-248787418 CCCTGGCCACTGTCCCATCTCCC No data
Right 924937853 1:248787449-248787471 TCTTGTATCCATGCAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937841 Original CRISPR GGGAGATGGGACAGTGGCCA GGG (reversed) Intergenic
No off target data available for this crispr