ID: 924937842

View in Genome Browser
Species Human (GRCh38)
Location 1:248787397-248787419
Sequence GGGGAGATGGGACAGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937842_924937852 24 Left 924937842 1:248787397-248787419 CCTGGCCACTGTCCCATCTCCCC No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937842_924937849 -1 Left 924937842 1:248787397-248787419 CCTGGCCACTGTCCCATCTCCCC No data
Right 924937849 1:248787419-248787441 CAGTTCTGAGATGAATATCCAGG No data
924937842_924937853 29 Left 924937842 1:248787397-248787419 CCTGGCCACTGTCCCATCTCCCC No data
Right 924937853 1:248787449-248787471 TCTTGTATCCATGCAGGGTCTGG No data
924937842_924937851 23 Left 924937842 1:248787397-248787419 CCTGGCCACTGTCCCATCTCCCC No data
Right 924937851 1:248787443-248787465 GTGTGCTCTTGTATCCATGCAGG No data
924937842_924937854 30 Left 924937842 1:248787397-248787419 CCTGGCCACTGTCCCATCTCCCC No data
Right 924937854 1:248787450-248787472 CTTGTATCCATGCAGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937842 Original CRISPR GGGGAGATGGGACAGTGGCC AGG (reversed) Intergenic
No off target data available for this crispr