ID: 924937844

View in Genome Browser
Species Human (GRCh38)
Location 1:248787409-248787431
Sequence CATCTCAGAACTGGGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937844_924937851 11 Left 924937844 1:248787409-248787431 CCCATCTCCCCAGTTCTGAGATG No data
Right 924937851 1:248787443-248787465 GTGTGCTCTTGTATCCATGCAGG No data
924937844_924937854 18 Left 924937844 1:248787409-248787431 CCCATCTCCCCAGTTCTGAGATG No data
Right 924937854 1:248787450-248787472 CTTGTATCCATGCAGGGTCTGGG No data
924937844_924937853 17 Left 924937844 1:248787409-248787431 CCCATCTCCCCAGTTCTGAGATG No data
Right 924937853 1:248787449-248787471 TCTTGTATCCATGCAGGGTCTGG No data
924937844_924937852 12 Left 924937844 1:248787409-248787431 CCCATCTCCCCAGTTCTGAGATG No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937844 Original CRISPR CATCTCAGAACTGGGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr