ID: 924937845

View in Genome Browser
Species Human (GRCh38)
Location 1:248787410-248787432
Sequence TCATCTCAGAACTGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937845_924937854 17 Left 924937845 1:248787410-248787432 CCATCTCCCCAGTTCTGAGATGA No data
Right 924937854 1:248787450-248787472 CTTGTATCCATGCAGGGTCTGGG No data
924937845_924937852 11 Left 924937845 1:248787410-248787432 CCATCTCCCCAGTTCTGAGATGA No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937845_924937853 16 Left 924937845 1:248787410-248787432 CCATCTCCCCAGTTCTGAGATGA No data
Right 924937853 1:248787449-248787471 TCTTGTATCCATGCAGGGTCTGG No data
924937845_924937851 10 Left 924937845 1:248787410-248787432 CCATCTCCCCAGTTCTGAGATGA No data
Right 924937851 1:248787443-248787465 GTGTGCTCTTGTATCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937845 Original CRISPR TCATCTCAGAACTGGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr