ID: 924937847

View in Genome Browser
Species Human (GRCh38)
Location 1:248787417-248787439
Sequence TGGATATTCATCTCAGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937847_924937852 4 Left 924937847 1:248787417-248787439 CCCAGTTCTGAGATGAATATCCA No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937847_924937854 10 Left 924937847 1:248787417-248787439 CCCAGTTCTGAGATGAATATCCA No data
Right 924937854 1:248787450-248787472 CTTGTATCCATGCAGGGTCTGGG No data
924937847_924937851 3 Left 924937847 1:248787417-248787439 CCCAGTTCTGAGATGAATATCCA No data
Right 924937851 1:248787443-248787465 GTGTGCTCTTGTATCCATGCAGG No data
924937847_924937853 9 Left 924937847 1:248787417-248787439 CCCAGTTCTGAGATGAATATCCA No data
Right 924937853 1:248787449-248787471 TCTTGTATCCATGCAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937847 Original CRISPR TGGATATTCATCTCAGAACT GGG (reversed) Intergenic
No off target data available for this crispr