ID: 924937852

View in Genome Browser
Species Human (GRCh38)
Location 1:248787444-248787466
Sequence TGTGCTCTTGTATCCATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937843_924937852 19 Left 924937843 1:248787402-248787424 CCACTGTCCCATCTCCCCAGTTC No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937845_924937852 11 Left 924937845 1:248787410-248787432 CCATCTCCCCAGTTCTGAGATGA No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937847_924937852 4 Left 924937847 1:248787417-248787439 CCCAGTTCTGAGATGAATATCCA No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937846_924937852 5 Left 924937846 1:248787416-248787438 CCCCAGTTCTGAGATGAATATCC No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937840_924937852 29 Left 924937840 1:248787392-248787414 CCATCCCTGGCCACTGTCCCATC No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937842_924937852 24 Left 924937842 1:248787397-248787419 CCTGGCCACTGTCCCATCTCCCC No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937848_924937852 3 Left 924937848 1:248787418-248787440 CCAGTTCTGAGATGAATATCCAG No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937844_924937852 12 Left 924937844 1:248787409-248787431 CCCATCTCCCCAGTTCTGAGATG No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data
924937841_924937852 25 Left 924937841 1:248787396-248787418 CCCTGGCCACTGTCCCATCTCCC No data
Right 924937852 1:248787444-248787466 TGTGCTCTTGTATCCATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937852 Original CRISPR TGTGCTCTTGTATCCATGCA GGG Intergenic
No off target data available for this crispr