ID: 924937949

View in Genome Browser
Species Human (GRCh38)
Location 1:248788325-248788347
Sequence GGTGATCCCAGGCTGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937949_924937962 22 Left 924937949 1:248788325-248788347 CCAGCCCCCAGCCTGGGATCACC No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937949_924937959 14 Left 924937949 1:248788325-248788347 CCAGCCCCCAGCCTGGGATCACC No data
Right 924937959 1:248788362-248788384 CCCCTAGCAGCCACCCACCCAGG No data
924937949_924937963 23 Left 924937949 1:248788325-248788347 CCAGCCCCCAGCCTGGGATCACC No data
Right 924937963 1:248788371-248788393 GCCACCCACCCAGGATAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937949 Original CRISPR GGTGATCCCAGGCTGGGGGC TGG (reversed) Intergenic
No off target data available for this crispr