ID: 924937953

View in Genome Browser
Species Human (GRCh38)
Location 1:248788332-248788354
Sequence AGCGGTGGGTGATCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937953_924937962 15 Left 924937953 1:248788332-248788354 CCAGCCTGGGATCACCCACCGCT No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937953_924937959 7 Left 924937953 1:248788332-248788354 CCAGCCTGGGATCACCCACCGCT No data
Right 924937959 1:248788362-248788384 CCCCTAGCAGCCACCCACCCAGG No data
924937953_924937968 24 Left 924937953 1:248788332-248788354 CCAGCCTGGGATCACCCACCGCT No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937953_924937963 16 Left 924937953 1:248788332-248788354 CCAGCCTGGGATCACCCACCGCT No data
Right 924937963 1:248788371-248788393 GCCACCCACCCAGGATAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937953 Original CRISPR AGCGGTGGGTGATCCCAGGC TGG (reversed) Intergenic
No off target data available for this crispr