ID: 924937956

View in Genome Browser
Species Human (GRCh38)
Location 1:248788347-248788369
Sequence GCTAGGGGCTGTGAAAGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937956_924937963 1 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937963 1:248788371-248788393 GCCACCCACCCAGGATAACAGGG No data
924937956_924937962 0 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937956_924937970 20 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937970 1:248788390-248788412 AGGGCCTCATGGAGTGTCTGAGG No data
924937956_924937959 -8 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937959 1:248788362-248788384 CCCCTAGCAGCCACCCACCCAGG No data
924937956_924937968 9 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937956_924937971 21 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937956 Original CRISPR GCTAGGGGCTGTGAAAGCGG TGG (reversed) Intergenic
No off target data available for this crispr