ID: 924937957

View in Genome Browser
Species Human (GRCh38)
Location 1:248788350-248788372
Sequence GCTGCTAGGGGCTGTGAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937957_924937970 17 Left 924937957 1:248788350-248788372 CCGCTTTCACAGCCCCTAGCAGC No data
Right 924937970 1:248788390-248788412 AGGGCCTCATGGAGTGTCTGAGG No data
924937957_924937963 -2 Left 924937957 1:248788350-248788372 CCGCTTTCACAGCCCCTAGCAGC No data
Right 924937963 1:248788371-248788393 GCCACCCACCCAGGATAACAGGG No data
924937957_924937968 6 Left 924937957 1:248788350-248788372 CCGCTTTCACAGCCCCTAGCAGC No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937957_924937971 18 Left 924937957 1:248788350-248788372 CCGCTTTCACAGCCCCTAGCAGC No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937957_924937962 -3 Left 924937957 1:248788350-248788372 CCGCTTTCACAGCCCCTAGCAGC No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937957 Original CRISPR GCTGCTAGGGGCTGTGAAAG CGG (reversed) Intergenic
No off target data available for this crispr