ID: 924937962

View in Genome Browser
Species Human (GRCh38)
Location 1:248788370-248788392
Sequence AGCCACCCACCCAGGATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937952_924937962 16 Left 924937952 1:248788331-248788353 CCCAGCCTGGGATCACCCACCGC No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937949_924937962 22 Left 924937949 1:248788325-248788347 CCAGCCCCCAGCCTGGGATCACC No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937955_924937962 1 Left 924937955 1:248788346-248788368 CCCACCGCTTTCACAGCCCCTAG No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937951_924937962 17 Left 924937951 1:248788330-248788352 CCCCAGCCTGGGATCACCCACCG No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937957_924937962 -3 Left 924937957 1:248788350-248788372 CCGCTTTCACAGCCCCTAGCAGC No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937953_924937962 15 Left 924937953 1:248788332-248788354 CCAGCCTGGGATCACCCACCGCT No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937950_924937962 18 Left 924937950 1:248788329-248788351 CCCCCAGCCTGGGATCACCCACC No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937954_924937962 11 Left 924937954 1:248788336-248788358 CCTGGGATCACCCACCGCTTTCA No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data
924937956_924937962 0 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937962 1:248788370-248788392 AGCCACCCACCCAGGATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937962 Original CRISPR AGCCACCCACCCAGGATAAC AGG Intergenic
No off target data available for this crispr