ID: 924937968

View in Genome Browser
Species Human (GRCh38)
Location 1:248788379-248788401
Sequence CCCAGGATAACAGGGCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937953_924937968 24 Left 924937953 1:248788332-248788354 CCAGCCTGGGATCACCCACCGCT No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937961_924937968 -8 Left 924937961 1:248788364-248788386 CCTAGCAGCCACCCACCCAGGAT No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937960_924937968 -7 Left 924937960 1:248788363-248788385 CCCTAGCAGCCACCCACCCAGGA No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937950_924937968 27 Left 924937950 1:248788329-248788351 CCCCCAGCCTGGGATCACCCACC No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937958_924937968 -6 Left 924937958 1:248788362-248788384 CCCCTAGCAGCCACCCACCCAGG No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937954_924937968 20 Left 924937954 1:248788336-248788358 CCTGGGATCACCCACCGCTTTCA No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937951_924937968 26 Left 924937951 1:248788330-248788352 CCCCAGCCTGGGATCACCCACCG No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937955_924937968 10 Left 924937955 1:248788346-248788368 CCCACCGCTTTCACAGCCCCTAG No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937956_924937968 9 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937957_924937968 6 Left 924937957 1:248788350-248788372 CCGCTTTCACAGCCCCTAGCAGC No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data
924937952_924937968 25 Left 924937952 1:248788331-248788353 CCCAGCCTGGGATCACCCACCGC No data
Right 924937968 1:248788379-248788401 CCCAGGATAACAGGGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937968 Original CRISPR CCCAGGATAACAGGGCCTCA TGG Intergenic
No off target data available for this crispr