ID: 924937971

View in Genome Browser
Species Human (GRCh38)
Location 1:248788391-248788413
Sequence GGGCCTCATGGAGTGTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924937964_924937971 -4 Left 924937964 1:248788372-248788394 CCACCCACCCAGGATAACAGGGC No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937956_924937971 21 Left 924937956 1:248788347-248788369 CCACCGCTTTCACAGCCCCTAGC No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937960_924937971 5 Left 924937960 1:248788363-248788385 CCCTAGCAGCCACCCACCCAGGA No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937955_924937971 22 Left 924937955 1:248788346-248788368 CCCACCGCTTTCACAGCCCCTAG No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937958_924937971 6 Left 924937958 1:248788362-248788384 CCCCTAGCAGCCACCCACCCAGG No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937965_924937971 -7 Left 924937965 1:248788375-248788397 CCCACCCAGGATAACAGGGCCTC No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937966_924937971 -8 Left 924937966 1:248788376-248788398 CCACCCAGGATAACAGGGCCTCA No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937961_924937971 4 Left 924937961 1:248788364-248788386 CCTAGCAGCCACCCACCCAGGAT No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data
924937957_924937971 18 Left 924937957 1:248788350-248788372 CCGCTTTCACAGCCCCTAGCAGC No data
Right 924937971 1:248788391-248788413 GGGCCTCATGGAGTGTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924937971 Original CRISPR GGGCCTCATGGAGTGTCTGA GGG Intergenic
No off target data available for this crispr