ID: 924941228

View in Genome Browser
Species Human (GRCh38)
Location 1:248813460-248813482
Sequence TACTCAGCTTTGCTGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924941220_924941228 23 Left 924941220 1:248813414-248813436 CCACGTCTTCCCCATGTTCTTGC 0: 1
1: 0
2: 1
3: 14
4: 209
Right 924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 195
924941223_924941228 12 Left 924941223 1:248813425-248813447 CCATGTTCTTGCCTAGTGTCACC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 195
924941226_924941228 -9 Left 924941226 1:248813446-248813468 CCTGCACCACTGGCTACTCAGCT 0: 1
1: 0
2: 0
3: 18
4: 206
Right 924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 195
924941222_924941228 13 Left 924941222 1:248813424-248813446 CCCATGTTCTTGCCTAGTGTCAC 0: 1
1: 0
2: 0
3: 12
4: 96
Right 924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 195
924941221_924941228 14 Left 924941221 1:248813423-248813445 CCCCATGTTCTTGCCTAGTGTCA 0: 1
1: 0
2: 0
3: 7
4: 158
Right 924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 195
924941224_924941228 1 Left 924941224 1:248813436-248813458 CCTAGTGTCACCTGCACCACTGG 0: 1
1: 0
2: 0
3: 22
4: 223
Right 924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG 0: 1
1: 0
2: 0
3: 24
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924941228 Original CRISPR TACTCAGCTTTGCTGCTGCC AGG Intronic
901198041 1:7451300-7451322 CACTGAGCTCTGCAGCTGCCTGG + Intronic
902042398 1:13502402-13502424 TCCCCAGCCTTGCTGCTCCCAGG + Intronic
902395608 1:16130958-16130980 TACACAGTGTGGCTGCTGCCTGG - Intronic
902492162 1:16790694-16790716 ATCTCAGGTTTGCTGCTGACAGG + Intronic
905234521 1:36536825-36536847 CACTCACCCTTGCTGCTTCCAGG + Intergenic
907089184 1:51709003-51709025 TGCTCAGCTCTGCTGCTGCTGGG - Intronic
908132011 1:61083197-61083219 GGCTCAGCGTTTCTGCTGCCGGG + Intronic
913070110 1:115290796-115290818 TACTCATCTTTGTTGCCCCCAGG + Intronic
913614307 1:120541889-120541911 TACTTGGCTTTCCTGCTCCCTGG + Intergenic
914374012 1:147056396-147056418 TACTTGGCTTTCCTGCTCCCCGG + Intergenic
914575962 1:148969011-148969033 TACTTGGCTTTCCTGCTCCCTGG - Exonic
917228738 1:172813478-172813500 TACTTCCCTTTGCTGCTGCCAGG - Intergenic
917674062 1:177302597-177302619 TAGTCAGAGTGGCTGCTGCCTGG + Intergenic
920335935 1:205245156-205245178 TACTCAGTGTTGCTTCAGCCTGG - Intronic
921104863 1:211966480-211966502 TAAACAGCTCTGCTGCTGTCTGG + Exonic
921709480 1:218359130-218359152 TATTCAGCTTTGCTTCTGCTTGG - Intronic
922167100 1:223125327-223125349 TACTCAGCCTTGCAGGTGCAGGG - Intronic
923528285 1:234791843-234791865 ATCTCAGGTTTGCTGCTGACAGG - Intergenic
923669812 1:236030795-236030817 TAAACAGATTTGCTGCTGTCAGG + Intronic
924210706 1:241764264-241764286 AGCTCATCTTTGATGCTGCCTGG + Intronic
924780362 1:247141707-247141729 TTCTCAGTTTTGCTGCTGTAGGG - Intronic
924941228 1:248813460-248813482 TACTCAGCTTTGCTGCTGCCAGG + Intronic
1064087591 10:12356899-12356921 TAATTAGGTTTGCTGGTGCCAGG + Intronic
1066192098 10:33065478-33065500 TACTCTGGTTTGGAGCTGCCTGG + Intergenic
1067285591 10:44905478-44905500 TACCCAGCTAAGCTGCTCCCAGG - Intergenic
1071186280 10:83049846-83049868 TACATAATTTTGCTGCTGCCAGG + Intergenic
1071293151 10:84201651-84201673 CACTCAGCTTTTCTGGTCCCAGG - Intronic
1073596156 10:104802498-104802520 TTCCCAGCTTTGCTGCTTCCTGG - Intronic
1073957311 10:108888356-108888378 TACTCAGCTTTGCCTTTGCCTGG - Intergenic
1077254312 11:1573557-1573579 TACTCAGCTCTGAGGCTGGCAGG - Intergenic
1078062220 11:8055617-8055639 GACTCAGCTCTGCTGCTGATGGG + Intronic
1079297334 11:19244904-19244926 CACACAGCCCTGCTGCTGCCTGG - Intergenic
1079773522 11:24495192-24495214 AACTCTGGTTTGCTCCTGCCAGG - Intergenic
1080227790 11:29979485-29979507 GCCTCAGCCTTGCTGCTGCTTGG - Intergenic
1080404095 11:31963565-31963587 TACTCATCATTGCTGCTACATGG - Intronic
1080668813 11:34358017-34358039 TACCCAGCTGTGCTGCCGGCCGG - Intergenic
1080976850 11:37353309-37353331 TAAGCAGATGTGCTGCTGCCTGG - Intergenic
1081573360 11:44304645-44304667 TATTGGCCTTTGCTGCTGCCAGG - Intronic
1081713200 11:45231207-45231229 TTCTCAGCTTGGATGCTCCCTGG + Intronic
1081910026 11:46694694-46694716 CTCTCAGCTTTGCTTCTGCAGGG + Intronic
1089042335 11:115463905-115463927 TCCTCAGCTTTCCAGCTGCCAGG + Intronic
1089554610 11:119309536-119309558 TACCCAGCTCAGCTGCTGGCAGG + Exonic
1090228181 11:125084009-125084031 TTCTCAGCTCTGATCCTGCCTGG + Intronic
1090335658 11:125961781-125961803 TACTCAGCGTACCTGCTGTCAGG - Exonic
1090615199 11:128507774-128507796 TCCTGAGCTAGGCTGCTGCCGGG - Intronic
1090988503 11:131795003-131795025 TACTCAGCCGTGCTCCTTCCTGG + Intronic
1091611328 12:2012418-2012440 TACTCAACTCTGCTGTTGCAAGG - Intronic
1092231561 12:6778442-6778464 GACTCAGGCTTGCTGCTGACAGG - Exonic
1092264211 12:6968804-6968826 TAGTCAGCTCTGCTGGTGACGGG - Intronic
1097071969 12:56361726-56361748 TCCTGTGCTTTGCTGCTCCCTGG + Exonic
1097794051 12:63843952-63843974 CCCTCAACTTTGCTGCCGCCGGG + Intergenic
1100146187 12:91680459-91680481 TACTCAATTTTCCTTCTGCCTGG - Intergenic
1101014826 12:100489395-100489417 TACTCAACTCTGCTACTGCAGGG + Intronic
1102216208 12:111163092-111163114 ATCTCAGCTCTGCTGCTGACTGG + Intronic
1102446563 12:113007526-113007548 AACTCAAATGTGCTGCTGCCAGG + Intronic
1103201276 12:119089996-119090018 GAATCTGCTTTGCTGCTTCCTGG - Intronic
1104341825 12:127957320-127957342 TGCTAAGCTTTGCTGCTGCATGG - Intergenic
1104815411 12:131642799-131642821 TACGGAGCTCTCCTGCTGCCAGG + Intergenic
1106595829 13:31135702-31135724 TCCTCAGCTCTGATGCTTCCTGG - Exonic
1107024181 13:35782913-35782935 TACTCAACTCTGCTGCTGTAGGG + Intronic
1108006334 13:45950563-45950585 TGCTGAGATTTGCTACTGCCTGG - Intergenic
1108600975 13:51995155-51995177 TAATCAGCTTGACTCCTGCCAGG + Intronic
1109057212 13:57565919-57565941 TTCACAGATTTGCTGGTGCCAGG + Intergenic
1110186625 13:72682866-72682888 TACCCAGCTAAGCTGCTCCCTGG - Intergenic
1110274898 13:73632419-73632441 GCCTCAGCTCTGGTGCTGCCTGG + Intergenic
1111788665 13:92824404-92824426 CAGTCATCTTTGCTGCTCCCAGG + Intronic
1113858815 13:113467631-113467653 TGCTCAGCTTCGTTGCTGACAGG + Intronic
1114724028 14:24914926-24914948 TTCTCAGCAATCCTGCTGCCTGG - Intronic
1119053633 14:71395615-71395637 TGCTCTGCTTTGCTCCAGCCTGG + Intronic
1120359019 14:83472482-83472504 TATTCTGCATTGCTGGTGCCTGG - Intergenic
1120547143 14:85826120-85826142 TGCTCAGCTTTGGGGCTTCCCGG - Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1121255051 14:92525062-92525084 TACCCAGCTTTGCCTCAGCCAGG - Intronic
1121660205 14:95629419-95629441 TACCCAGCTATGCTTCTCCCTGG + Intergenic
1122094311 14:99360271-99360293 TACTGGGCTCTGCTCCTGCCTGG + Intergenic
1122361502 14:101169554-101169576 TGCTCGGCCTTGCTGCTGCTGGG + Intergenic
1127697230 15:61462176-61462198 TGCTCATCATTGCTGCTTCCAGG + Intergenic
1128258223 15:66213836-66213858 TTCTCAGCTTAGCTCCTGGCAGG - Intronic
1130228974 15:82082172-82082194 AACTCAGCTTTTCTGATGCTCGG - Intergenic
1130406262 15:83604788-83604810 TACCCAGCTCTGCTACTTCCTGG - Intronic
1130417854 15:83710897-83710919 CACTTGGCTTTGCTACTGCCTGG - Intronic
1131165409 15:90138682-90138704 AACTCAGCATTCCTCCTGCCAGG - Intergenic
1132037865 15:98501628-98501650 TACACAGCTATGCTCCTGCCAGG - Intronic
1132203829 15:99973119-99973141 CACTCTGCTTGTCTGCTGCCAGG + Exonic
1132793753 16:1708060-1708082 AACTCAGCTTTGCTGGAACCGGG - Intronic
1137246074 16:46706118-46706140 TACTCAGATTTTCTACTGCAAGG - Intergenic
1137438626 16:48479469-48479491 TGCTCAGCTTTCAAGCTGCCAGG + Intergenic
1139307987 16:66004310-66004332 TTCCCAGCTCTGCTGCTTCCTGG - Intergenic
1139417911 16:66829634-66829656 TGCTCAGCTTTCCTCCTTCCTGG - Intronic
1143315337 17:6027739-6027761 GAGCCACCTTTGCTGCTGCCAGG - Intronic
1144354027 17:14427234-14427256 CACTCAGCTTAGTTTCTGCCAGG - Intergenic
1145890873 17:28414776-28414798 TCCTGTGCTGTGCTGCTGCCTGG + Intergenic
1145909242 17:28533133-28533155 GATTCAGCTTGGCTGCTCCCTGG + Intronic
1146439200 17:32878516-32878538 AACCCAGCTCTGCTGGTGCCAGG - Intergenic
1148853423 17:50565721-50565743 TCCTCACCCTTGCGGCTGCCAGG + Intronic
1150041301 17:61863906-61863928 TACCCAGCTTTGCAGTAGCCAGG + Intergenic
1152514157 17:80812562-80812584 TACTCAGCGTCCCTGCTGCTGGG + Intronic
1152800689 17:82329429-82329451 TACTGAGCATAGCGGCTGCCTGG - Intronic
1153654385 18:7270079-7270101 AACTCAGCTCTTCTGCTGCCTGG - Intergenic
1159565540 18:70043909-70043931 TTCTCAGCCTTGCTGCCTCCAGG - Intronic
1160251876 18:77210237-77210259 TGCTCAGGGTTGTTGCTGCCGGG + Intergenic
1161594999 19:5146569-5146591 TATTCTCTTTTGCTGCTGCCTGG - Intronic
1161768192 19:6218118-6218140 CACTCAGCGTAGCTGCTGCCAGG - Intronic
1162935509 19:13979715-13979737 AACTCAGCCCTGCTGCTTCCTGG - Intronic
1167402912 19:49284810-49284832 TACTCAGGTTAACTGCTGCGAGG - Intergenic
925844531 2:8023589-8023611 TACTCTGCTGTGCTGGTGGCGGG - Intergenic
929139027 2:38651271-38651293 TACTCAGCCATCCTTCTGCCTGG + Intergenic
929942122 2:46342172-46342194 TTCTCAGTTTTGCTGCTCACTGG - Intronic
930871928 2:56179596-56179618 CACTCACCTTTGCCTCTGCCAGG + Intergenic
932205190 2:69874257-69874279 TACTCTCCTGTACTGCTGCCAGG - Intronic
932879885 2:75491442-75491464 TAATCAGCTTTGATGCTCCCTGG + Intronic
933242709 2:79941068-79941090 TAATCAGCTTTGTGGCTGCCAGG + Intronic
934614983 2:95765061-95765083 CACTCTGCTTTTCTGCTGGCTGG + Intergenic
934645920 2:96059426-96059448 CACTCTGCTTTTCTGCTGGCTGG - Intergenic
934839323 2:97615516-97615538 CACTCTGCTTTTCTGCTGGCTGG - Intergenic
935173608 2:100629285-100629307 AACTCTACTTTGATGCTGCCGGG + Intergenic
937897612 2:126990468-126990490 CACACTGCTTTGCTGCTGCAAGG + Intergenic
939410421 2:141817416-141817438 TACTAAGCTTTTCTCATGCCAGG - Intronic
942305791 2:174606526-174606548 TACTCATCTTTTATGCTGGCAGG + Intronic
942438119 2:176002711-176002733 TAATTTGCTTTGCTGCTGGCTGG - Intronic
945890776 2:215428454-215428476 TATTCAGCTCTGGTGCTGCAAGG + Intronic
946235354 2:218321597-218321619 AGCTCACCTTTGCTGCTGCTGGG - Intronic
946402057 2:219473325-219473347 ACCTCAGCTTTGCTGCTCTCTGG + Intronic
948600132 2:239103200-239103222 TACTTTGCTTTCCAGCTGCCAGG + Intronic
1168961687 20:1874453-1874475 TCCCCAGCTTTGCTGCTGTGGGG - Intergenic
1173993143 20:47318338-47318360 TGCTCTGCTTTGCTGCTTCTGGG - Intronic
1175409673 20:58758601-58758623 TACTCAGCTACTCAGCTGCCAGG - Intergenic
1180981505 22:19880150-19880172 TCCTCAGCTGTGCTGCTCCCAGG + Intronic
1181936902 22:26445550-26445572 TCCTCAGCTTTTCTGAAGCCAGG - Intronic
1182110361 22:27718770-27718792 TTCTCAGCTTTGCTGAGTCCTGG - Intergenic
1183354708 22:37351930-37351952 CACTCATCTTTGCGCCTGCCTGG + Intergenic
949323394 3:2837419-2837441 TAATCCGCTTTGCTCCTGCCTGG + Intronic
949337634 3:2993256-2993278 TACTCAACTTTGCTGTTGTAAGG - Intronic
955732636 3:62003396-62003418 TTCTCAGCTTTGAATCTGCCAGG - Exonic
956718884 3:72100933-72100955 AACTCAGCTTTGCCCCTGCACGG - Intergenic
959181788 3:102989442-102989464 TACTCAGATTTTCAGCTGCACGG - Intergenic
960160067 3:114340637-114340659 TTCTCAGCTCTGCTCCTGACAGG + Intronic
961646034 3:128393254-128393276 TGCTCAGCTCTGCAGGTGCCTGG - Intronic
961754414 3:129119619-129119641 TACACAGCTCTTCTGCTCCCTGG + Intronic
962271035 3:133978338-133978360 TACTCAGGCTTTCTGATGCCGGG + Intronic
962594979 3:136933095-136933117 TACTCATGTAAGCTGCTGCCAGG - Intronic
965152580 3:164998469-164998491 TACTCACTTTTGCTGGTGCTAGG - Intronic
968579563 4:1383615-1383637 CTCTCAGGCTTGCTGCTGCCAGG + Intronic
968759150 4:2433121-2433143 CACTCAGCTCTGCAGCTTCCAGG + Intronic
968832297 4:2939128-2939150 CACTCAGCTTTGGTGCTGTGTGG - Intronic
969216243 4:5724519-5724541 AACTCAGCTTTGCTGGCCCCAGG - Intronic
969534500 4:7747536-7747558 CACTCAGCTTCTCTGCAGCCTGG - Intergenic
971278348 4:25219216-25219238 TACTCAGATTTGCGGCTGTGAGG - Intronic
971448140 4:26774291-26774313 TAATCAGCTATGCTGATTCCTGG + Intergenic
971971807 4:33630768-33630790 GACTCAGCTTAGCTGATCCCTGG - Intergenic
976260072 4:83136961-83136983 TCCACAGCTGTGGTGCTGCCCGG + Intronic
978686370 4:111449775-111449797 TACTCAGCTTTTCTTCTGGCTGG + Intergenic
979121605 4:116909748-116909770 TACTCAACATTGCTGTGGCCAGG + Intergenic
979764769 4:124451057-124451079 CACCCAGCTTTCCTGCTTCCAGG - Intergenic
981329091 4:143487866-143487888 CACCCAGATTTGCTGCTGCTTGG - Intergenic
988166687 5:27599590-27599612 TACTAATCTTTTCTGCTGCAGGG - Intergenic
989571468 5:42950013-42950035 GTCTCAGACTTGCTGCTGCCAGG - Intergenic
992076814 5:73199397-73199419 TCCTCATCTTTCCTGCTTCCTGG - Intergenic
992729194 5:79641498-79641520 TACTCTTCTTTGCTGCATCCTGG - Intronic
995197970 5:109395070-109395092 GAATTAGCTTTGCTTCTGCCGGG - Intronic
997481466 5:134188262-134188284 CACTCAGCTCAGCTGGTGCCTGG + Intronic
1000629213 5:163572842-163572864 TACTCAGCTGCCTTGCTGCCTGG - Intergenic
1000998909 5:167986674-167986696 TACACATTTTTGCTGATGCCTGG + Intronic
1001732654 5:173971937-173971959 CACTCAGTTTTCCTGCTACCAGG + Intergenic
1003988592 6:11462906-11462928 CACTGAGCTTGGCTGCTGACAGG + Intergenic
1004065802 6:12242661-12242683 ATCTCAGCCTTGCTGCTCCCTGG + Intergenic
1005767467 6:29027176-29027198 CCCTCAGCTTTGCCACTGCCTGG - Intergenic
1005982084 6:30844315-30844337 AACCCAGCTGTGCTGCTGCAAGG - Intergenic
1006844337 6:37051896-37051918 TCCACAGCTGTGCAGCTGCCTGG - Intergenic
1007363550 6:41374625-41374647 TGCGCAGCTCTTCTGCTGCCGGG + Intergenic
1007618971 6:43200043-43200065 CACTCAGCTCAGCTGCTGCTGGG + Exonic
1012187403 6:96236253-96236275 AACTCAGCCTTTCTGCTTCCTGG - Intergenic
1013007093 6:106083864-106083886 TGCACAGCTGTACTGCTGCCAGG + Intergenic
1017666834 6:156727742-156727764 TTGGCAGCTTTGCTTCTGCCAGG + Intergenic
1019017630 6:168891378-168891400 TCCTCTCCTTTGCTTCTGCCTGG + Intergenic
1019214596 6:170435079-170435101 TGCTCAGCTGTGCTGATGCCAGG - Intergenic
1019707951 7:2505321-2505343 TTCCCAGCTCTGCTGCCGCCTGG + Intergenic
1021599913 7:22355276-22355298 TACTCATGTTTCTTGCTGCCTGG - Intronic
1021604691 7:22397936-22397958 TTTCCTGCTTTGCTGCTGCCAGG - Intergenic
1024769397 7:52700920-52700942 TCAACAGCTTTGCTGCTGGCAGG - Intergenic
1025074446 7:55930803-55930825 CACTCAGCTCTGCTGTTGCAGGG - Intronic
1025557486 7:62327346-62327368 GAATCAGCTTTGATGCAGCCAGG + Intergenic
1025971295 7:66328407-66328429 TACTCAGCTCTACTGCTGCAGGG - Intronic
1028158262 7:87456833-87456855 AACTCAGAGTTTCTGCTGCCTGG + Intronic
1030535372 7:110759859-110759881 TAAGCAACTTTGCTTCTGCCAGG - Intronic
1030598112 7:111562901-111562923 TATTCAGTTTTGCTGCCTCCAGG + Intergenic
1031817877 7:126461536-126461558 TATTCACCTTTGCTGCTTCCAGG + Intronic
1031823424 7:126532945-126532967 TACTTACCTTTTCTGCTGACTGG + Exonic
1038455450 8:27669602-27669624 ATCTCAGCCTTGCTGCTGGCAGG + Intronic
1042097867 8:65238223-65238245 TACTCAGCTCAGCTTCTTCCCGG - Intergenic
1042470688 8:69184214-69184236 TACTCTGCAATTCTGCTGCCAGG + Intergenic
1042746260 8:72110067-72110089 TACTCAACTTTGTTGCTGTCAGG - Intronic
1042944853 8:74144709-74144731 TGCACATCTTTGCTGCTGCAAGG - Intergenic
1045430488 8:102109468-102109490 TACTCAGCTTTGCTGTCTGCTGG - Intronic
1048713058 8:137233523-137233545 GTCTCAGCTTTGGTGCTACCTGG - Intergenic
1049620577 8:143596639-143596661 TACACAGTTCTTCTGCTGCCAGG + Intronic
1049939647 9:533113-533135 CACTCAGCTTTGCCTCTGACTGG - Intronic
1051242044 9:15068025-15068047 GGCTTAGCATTGCTGCTGCCTGG - Intergenic
1056544636 9:87603409-87603431 TTCTCAGCTATCCTGCTGCAGGG + Intronic
1058022137 9:100099915-100099937 GCTTCAGCTTTCCTGCTGCCTGG + Intronic
1059959764 9:119553470-119553492 GACTCAGCTGTGCTGTTTCCTGG - Intergenic
1061339253 9:129966045-129966067 TACACAGCTTTCCTCGTGCCTGG - Intronic
1061591162 9:131598456-131598478 TCCTCAGCTCTGCTACTGACTGG + Intronic
1061823595 9:133242557-133242579 ATCGCAGCTTTGCTGCTGCCTGG - Intergenic
1186294483 X:8133943-8133965 TCCTCAGCTTTCCTGGTGTCTGG - Intergenic
1186383856 X:9089515-9089537 CATTCGGCTTTGCTGCTGTCAGG - Intronic
1186420443 X:9421160-9421182 TACTCAACTTTCCTGCTTTCAGG + Intergenic
1186706351 X:12143444-12143466 TATTCAACTTTGCTGTTGTCAGG - Intronic
1186981682 X:14963911-14963933 TACTCAGCTCTGCTGCTGTAGGG + Intergenic
1188351788 X:29140382-29140404 TATTCATCTTTGCTTCTTCCTGG - Intronic
1195438521 X:104874042-104874064 GACTGATCTTTGATGCTGCCAGG + Intronic
1197530702 X:127621981-127622003 TACTCATGTTAGCTCCTGCCGGG - Intergenic
1199875083 X:151922397-151922419 TACTCATGTTTGCTCCTGACAGG - Intronic
1199947732 X:152681526-152681548 TATTCATCTTTACTCCTGCCGGG - Intergenic
1199952294 X:152715828-152715850 TACTCATCTTTACTCCTGCCAGG - Intronic
1199954924 X:152735019-152735041 TACTCATCTTTACTCCTGCCAGG - Intronic
1199957389 X:152752620-152752642 TACTCATCTTTACTCCTGCCAGG + Intronic
1199961947 X:152786928-152786950 TATTCATCTTTACTCCTGCCGGG + Intergenic
1201288967 Y:12403985-12404007 TTCTCAGCACTGCTGCTGTCTGG + Intergenic
1202027948 Y:20544071-20544093 TATTAAGCTTTGCTGCTGGAGGG + Intergenic