ID: 924943172

View in Genome Browser
Species Human (GRCh38)
Location 1:248826243-248826265
Sequence CTTGCTTTACGGAGCTGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924943168_924943172 -2 Left 924943168 1:248826222-248826244 CCTCAGAGTGAGTAGTGCCATCT 0: 1
1: 0
2: 0
3: 9
4: 105
Right 924943172 1:248826243-248826265 CTTGCTTTACGGAGCTGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924943172 Original CRISPR CTTGCTTTACGGAGCTGCGG CGG Exonic
901478124 1:9504796-9504818 CTTACTGTAGGGATCTGCGGGGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
910432683 1:87174665-87174687 CTGACTTAACAGAGCTGCGGAGG + Intergenic
917213601 1:172655963-172655985 CTTGCTTTACGGGGGTTGGGAGG - Intergenic
917798874 1:178552544-178552566 CTTGCTTTAGGTAGCTGGGGTGG - Intergenic
924943172 1:248826243-248826265 CTTGCTTTACGGAGCTGCGGCGG + Exonic
1065651760 10:27899719-27899741 GTGGCTTTGCGGAGCTGTGGTGG - Intronic
1070309300 10:75261755-75261777 CTTGTTTTATGGAGCTGAGATGG - Intergenic
1076914630 10:133416076-133416098 AAAGCTTTACTGAGCTGCGGTGG - Intronic
1083632594 11:64103516-64103538 CTTGCATGACGGAGCTGAGAGGG - Exonic
1086380277 11:86245162-86245184 CTTGCTTGACGGCGGTGTGGCGG + Exonic
1089683713 11:120133686-120133708 CTTGCTTTTCTGAGCAGCGCTGG - Intronic
1089854870 11:121534683-121534705 CTTGCTTTTCAGAGCAGCAGGGG - Intronic
1094216061 12:27944067-27944089 CTTGCTTTAAGGAGCTTAGTGGG + Intergenic
1095356444 12:41280618-41280640 GTGGCTTTGCTGAGCTGCGGTGG - Intronic
1095778893 12:46037286-46037308 GTGGCTTTACTGAGCTGCAGTGG - Intergenic
1096805057 12:54135625-54135647 CCTGCTTTCAGGAGCTGGGGCGG - Intergenic
1098906631 12:76169592-76169614 GTGGCTTTGCTGAGCTGCGGTGG + Intergenic
1099053444 12:77808909-77808931 GTGGCCTTGCGGAGCTGCGGTGG + Intergenic
1101361837 12:104034659-104034681 CTGGCTTTGCGGAGCTGTGGTGG - Intronic
1102438604 12:112944560-112944582 CCTGCTTCACAGAGCTGCGGAGG + Exonic
1102440576 12:112961155-112961177 CCTGCTTCGCAGAGCTGCGGAGG + Exonic
1102980081 12:117234520-117234542 CCTGCTCTAGGGAGCTGCAGAGG - Intronic
1106983839 13:35321831-35321853 GTGGCTTTGCTGAGCTGCGGAGG + Intronic
1108599886 13:51983320-51983342 GTAGCTTTGCTGAGCTGCGGAGG - Intronic
1110039559 13:70735739-70735761 CATGCTTTACCCAGCTGCTGAGG - Intergenic
1114870097 14:26645531-26645553 CTGGCTTTGCTGAACTGCGGTGG + Intergenic
1115721076 14:36161943-36161965 GTGGCTTTGCGGAGCTGCGGTGG + Intergenic
1123004623 14:105315195-105315217 CGCGCTTGCCGGAGCTGCGGGGG - Exonic
1129499133 15:76019066-76019088 GTGGCTTTGCTGAGCTGCGGTGG + Intronic
1142220456 16:88851876-88851898 CAGGCTTTGCAGAGCTGCGGTGG - Intronic
1151161891 17:72173006-72173028 CTTGCTTTTTGGAGCAGGGGAGG + Intergenic
1151332881 17:73421468-73421490 CTTGTTCTACGGAGCTGGAGAGG + Intronic
1153798483 18:8647131-8647153 GTGGCTTTGCGGTGCTGCGGTGG - Intergenic
1157245667 18:46052114-46052136 CTTGCTTTCTAGAGCTGCTGAGG - Intronic
1158853398 18:61518025-61518047 GTGGCTTTGCAGAGCTGCGGTGG - Intronic
1159701235 18:71630814-71630836 CTTGCTATACTGAGCTTCAGTGG - Intergenic
1160476293 18:79192017-79192039 CTGGCATTAGGGAGCTGCTGTGG + Intronic
1168312551 19:55468220-55468242 CTTGCTTTACTGAGCAGTGGAGG + Intergenic
925252434 2:2451428-2451450 GCAGCTTTGCGGAGCTGCGGTGG + Intergenic
929562785 2:42966301-42966323 CTGGGTTGAAGGAGCTGCGGGGG - Intergenic
932834748 2:75025908-75025930 CTTGCTTTATGTAGTTGCTGTGG + Intergenic
934946834 2:98548383-98548405 CTGGCTGTGCAGAGCTGCGGTGG - Intronic
948408165 2:237738436-237738458 CTTGCTATATGGTGCTGCGTGGG + Intronic
1171947004 20:31387721-31387743 CCTGCTTCAAGGAGCTGCAGGGG - Intronic
1173040940 20:39461632-39461654 CTTGTTTTAGGGGGCCGCGGGGG + Intergenic
1173207309 20:41005228-41005250 CTTACCTTAAGGAGCTGCAGAGG + Intergenic
1174519525 20:51118860-51118882 CTTGCTTTAAGGCTCTGCTGTGG - Intergenic
1176546626 21:8205136-8205158 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1176554520 21:8249327-8249349 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1176565577 21:8388183-8388205 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1176573442 21:8432351-8432373 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1182832557 22:33315568-33315590 CTTGGTTTTCGGTGCTGGGGAGG + Intronic
1184160458 22:42694401-42694423 CCTGGTTTATGGAGCTGAGGCGG - Intronic
1203251491 22_KI270733v1_random:121402-121424 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1203259541 22_KI270733v1_random:166484-166506 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
950110625 3:10416603-10416625 TTTGCTTAACAGAGCTGAGGTGG - Intronic
954851487 3:53604629-53604651 CCTGCTTTACAGACCTGCTGTGG + Intronic
955656381 3:61249503-61249525 CTTACCTTACAGAGCTGAGGAGG - Intronic
959278232 3:104304705-104304727 GCTGCTTTGTGGAGCTGCGGTGG - Intergenic
962527541 3:136250270-136250292 CTGGCTGTAGGGAGCCGCGGGGG - Intergenic
962642339 3:137400557-137400579 CTGGCTTTGCCTAGCTGCGGTGG + Intergenic
965511130 3:169568624-169568646 GTGGCTTTGCTGAGCTGCGGTGG - Intronic
976534309 4:86193487-86193509 CTGGCTTTGCTGAGCTGTGGTGG + Intronic
978601396 4:110431900-110431922 GTGGCTTTGCTGAGCTGCGGTGG + Intronic
983044497 4:162969597-162969619 GTGGCTTTGCTGAGCTGCGGTGG + Intergenic
984618665 4:181927428-181927450 GTGGCTTTGCTGAGCTGCGGTGG - Intergenic
990745832 5:58958822-58958844 ATGGCTTTGCTGAGCTGCGGAGG + Intergenic
992740596 5:79770037-79770059 GTGGCTTTGCTGAGCTGCGGTGG + Intronic
993960942 5:94296141-94296163 ATGGCTTTGCTGAGCTGCGGGGG + Intronic
994005147 5:94828689-94828711 GTAGCTTTGCTGAGCTGCGGTGG + Intronic
994991291 5:106999992-107000014 GTGGCTTTGTGGAGCTGCGGTGG + Intergenic
999201585 5:149820521-149820543 CCTGCTTTGGGGAGCTGCAGTGG + Exonic
999788990 5:154920058-154920080 CTTGCTTTATACAGCTGTGGAGG - Exonic
1008896821 6:56565930-56565952 GCAGCTTTACTGAGCTGCGGTGG + Intronic
1010459487 6:76097952-76097974 GTGGCTTTACTGAGCTGCAGTGG - Intergenic
1014387050 6:120815929-120815951 GTGGCTTTGCGGAGCTGTGGTGG + Intergenic
1014461643 6:121703427-121703449 CTGGCCTTGCTGAGCTGCGGTGG - Intergenic
1016483471 6:144507972-144507994 GTTGCTTTTCTGAGCTGTGGTGG + Intronic
1016638684 6:146324128-146324150 GCGGCTTTGCGGAGCTGCGGTGG + Intronic
1018562914 6:165120910-165120932 CTTTCTTTAAGGAGCTGCAGTGG + Intergenic
1022508906 7:30922968-30922990 TTTGGTTTCCTGAGCTGCGGAGG + Intronic
1022867009 7:34431820-34431842 CCAGCCTTACTGAGCTGCGGTGG - Intergenic
1030703059 7:112662296-112662318 CTGGCCTTACTGAGCTGCAGTGG + Intergenic
1035380661 7:158438517-158438539 CCTGCTTTGGGGAGCTGCGGAGG - Intronic
1037258265 8:16979552-16979574 GTGGCTTTTCGAAGCTGCGGAGG + Intergenic
1042478826 8:69280600-69280622 GTGGCTTTACCGAGCTGCAGTGG - Intergenic
1044503584 8:92991158-92991180 GTGGCTTTGTGGAGCTGCGGTGG - Intronic
1045299917 8:100902087-100902109 CTTGCTTCCTGGAGCTGCTGTGG + Intergenic
1052317745 9:27133653-27133675 CTTGCTTTATGGAGCTCGAGGGG + Intronic
1055594274 9:77849617-77849639 CTTGCTTTGTGGAACTGTGGTGG - Intronic
1059759042 9:117321012-117321034 CTTGCTTGACAGAGTTGTGGAGG - Intronic
1203467893 Un_GL000220v1:104553-104575 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1203475714 Un_GL000220v1:148525-148547 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1186107845 X:6226474-6226496 CTTTCTTCCCGGAGCGGCGGGGG - Intronic
1188893270 X:35636097-35636119 CTGGCTTTGCCAAGCTGCGGTGG + Intergenic
1190280175 X:48924039-48924061 CTGGCTTTCCGGGGCTGCAGCGG + Exonic
1191657467 X:63613874-63613896 GTGGCTTTACCGAGCTGCGGTGG - Intergenic
1195310922 X:103631054-103631076 CTTGCTTTACAGTGCTACTGTGG + Intergenic
1200803332 Y:7407075-7407097 GTGGCTTTGCTGAGCTGCGGTGG - Intergenic
1201563575 Y:15343599-15343621 GTGGCTTTGCTGAGCTGCGGTGG + Intergenic