ID: 924943591 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:248829775-248829797 |
| Sequence | CATCAGAGGGAGACCGTGCA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924943591_924943598 | 11 | Left | 924943591 | 1:248829775-248829797 | CCCTGCACGGTCTCCCTCTGATG | No data | ||
| Right | 924943598 | 1:248829809-248829831 | CTCTGATGCCGAGCCGAAGCTGG | 0: 419 1: 561 2: 478 3: 168 4: 133 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924943591 | Original CRISPR | CATCAGAGGGAGACCGTGCA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||