ID: 924943591

View in Genome Browser
Species Human (GRCh38)
Location 1:248829775-248829797
Sequence CATCAGAGGGAGACCGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924943591_924943598 11 Left 924943591 1:248829775-248829797 CCCTGCACGGTCTCCCTCTGATG No data
Right 924943598 1:248829809-248829831 CTCTGATGCCGAGCCGAAGCTGG 0: 419
1: 561
2: 478
3: 168
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924943591 Original CRISPR CATCAGAGGGAGACCGTGCA GGG (reversed) Intergenic
No off target data available for this crispr