ID: 924949477

View in Genome Browser
Species Human (GRCh38)
Location 1:248868894-248868916
Sequence ACACATATACTGAAAGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11628
Summary {0: 2, 1: 37, 2: 375, 3: 1542, 4: 9672}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924949473_924949477 22 Left 924949473 1:248868849-248868871 CCAACTATATGTTGCCTACAAAG No data
Right 924949477 1:248868894-248868916 ACACATATACTGAAAGTAAAGGG 0: 2
1: 37
2: 375
3: 1542
4: 9672
924949474_924949477 8 Left 924949474 1:248868863-248868885 CCTACAAAGCACTCACTTCACCT No data
Right 924949477 1:248868894-248868916 ACACATATACTGAAAGTAAAGGG 0: 2
1: 37
2: 375
3: 1542
4: 9672
924949472_924949477 23 Left 924949472 1:248868848-248868870 CCCAACTATATGTTGCCTACAAA No data
Right 924949477 1:248868894-248868916 ACACATATACTGAAAGTAAAGGG 0: 2
1: 37
2: 375
3: 1542
4: 9672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924949477 Original CRISPR ACACATATACTGAAAGTAAA GGG Intergenic
Too many off-targets to display for this crispr