ID: 924951017

View in Genome Browser
Species Human (GRCh38)
Location 1:248883421-248883443
Sequence CTCCATTTAAAAATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15601
Summary {0: 4, 1: 85, 2: 752, 3: 3178, 4: 11582}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924951017 Original CRISPR CTCCATTTAAAAATGGGCAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr