ID: 924952924

View in Genome Browser
Species Human (GRCh38)
Location 1:248901874-248901896
Sequence TCTGATATCCAGAGTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924952922_924952924 21 Left 924952922 1:248901830-248901852 CCAGAATGGGAGAAAAATTTTGC No data
Right 924952924 1:248901874-248901896 TCTGATATCCAGAGTCTACAAGG No data
924952921_924952924 24 Left 924952921 1:248901827-248901849 CCTCCAGAATGGGAGAAAAATTT No data
Right 924952924 1:248901874-248901896 TCTGATATCCAGAGTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924952924 Original CRISPR TCTGATATCCAGAGTCTACA AGG Intergenic
No off target data available for this crispr