ID: 924953399

View in Genome Browser
Species Human (GRCh38)
Location 1:248906181-248906203
Sequence GCCCGGGGGCGTGGCATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 1, 3: 31, 4: 219}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924953383_924953399 17 Left 924953383 1:248906141-248906163 CCTGGAGTCTCGATGGTCGCTCG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 924953399 1:248906181-248906203 GCCCGGGGGCGTGGCATGGAAGG 0: 1
1: 1
2: 1
3: 31
4: 219
924953381_924953399 27 Left 924953381 1:248906131-248906153 CCGCGGAGGTCCTGGAGTCTCGA 0: 1
1: 0
2: 0
3: 5
4: 77
Right 924953399 1:248906181-248906203 GCCCGGGGGCGTGGCATGGAAGG 0: 1
1: 1
2: 1
3: 31
4: 219
924953393_924953399 -8 Left 924953393 1:248906166-248906188 CCGGGGCGTGGCCTGGCCCGGGG 0: 1
1: 1
2: 3
3: 58
4: 457
Right 924953399 1:248906181-248906203 GCCCGGGGGCGTGGCATGGAAGG 0: 1
1: 1
2: 1
3: 31
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924953399 Original CRISPR GCCCGGGGGCGTGGCATGGA AGG Intronic
900323587 1:2096601-2096623 TCCCCGTGGCGTGGCATGGACGG + Intronic
900342278 1:2194794-2194816 GGGCGGGGGCGGGGCCTGGAGGG - Intronic
901064943 1:6490123-6490145 GCCCGGGCGCGCGGCGTGGCTGG - Intronic
901629660 1:10641955-10641977 GCCCCGGAGCGTGGCCTGGAGGG + Intronic
901791298 1:11654839-11654861 GCGCGGGGGCGGGGCCTGGCGGG + Exonic
902380049 1:16048590-16048612 CCCAGGGGGCGGGGCATGAAGGG - Intronic
902441091 1:16430517-16430539 GCTCTGGGGAGGGGCATGGAGGG + Intronic
903059845 1:20661913-20661935 TCCAGGGGCCATGGCATGGACGG + Intergenic
903266109 1:22159072-22159094 GCCCTGGGGCGTGGCTTTGGCGG + Intergenic
903323548 1:22556465-22556487 GCCAGGGGGCGGGGCAGGGGCGG + Intergenic
903879837 1:26501000-26501022 CACCGGGGGCGGGGCCTGGAAGG + Intergenic
904256946 1:29260118-29260140 GCCCGGGGGCGTGGCCGTGGGGG + Intronic
904782848 1:32964024-32964046 GCGCGGGGGCGTGGCGCGGGTGG - Intronic
906511064 1:46410704-46410726 GCCCTGGGGGGAGGCATGGAGGG + Intronic
911159791 1:94672630-94672652 GCCCAGTGGCTGGGCATGGAAGG - Intergenic
914196982 1:145452678-145452700 GCTTGGGGGTGTCGCATGGAAGG - Intergenic
915631042 1:157154528-157154550 GCCTGAGGGCGTGGGAAGGAGGG - Intergenic
916760166 1:167808861-167808883 GCCTGATGGCCTGGCATGGAGGG - Intergenic
919792764 1:201302774-201302796 GCCCAAGGGCGAGGCCTGGAAGG + Intronic
923504171 1:234591329-234591351 GCCCTGGGGCTTGGCAGGGAAGG + Intergenic
923706422 1:236348222-236348244 GCTCGGGGGCGTGGCACTGCAGG - Intergenic
923860140 1:237885131-237885153 GCCCTGGTGAGTGTCATGGAAGG + Intronic
924953399 1:248906181-248906203 GCCCGGGGGCGTGGCATGGAAGG + Intronic
1062904753 10:1172394-1172416 TCCCGGGGGCCTGGCATGCTAGG - Intergenic
1063080831 10:2765804-2765826 GCCCGGGGGCTTGGCACTGAAGG - Intergenic
1063664532 10:8053564-8053586 GAGCGGGGGCGGGGCCTGGAGGG - Intergenic
1066036390 10:31491490-31491512 GCCCTGGGGCATGGCAGTGAAGG - Intronic
1067069207 10:43119938-43119960 GGCCGGGGGTGTGGCATGGCAGG - Intronic
1067830786 10:49610161-49610183 GGCCGGGGGCGGGGCGTGGCCGG - Intronic
1069988048 10:72297668-72297690 GCCCGGGGGAGCGGGAAGGAGGG - Intergenic
1070535246 10:77372292-77372314 GCCCTGGGGAGTGGCAGCGATGG - Intronic
1071069072 10:81670227-81670249 GCCCTGGGGAGGGGCATGGCTGG + Intergenic
1072891642 10:99329837-99329859 TCCCGGGGGCGTGGCAGGCTCGG + Exonic
1076146499 10:128126321-128126343 GCCCGGGGACGTAGCCTGTAGGG - Exonic
1077038576 11:507299-507321 GCGCGGGGGCGGGGCCTGGCGGG + Intronic
1077159818 11:1107590-1107612 CCCCGGGGGCTTGGCCTGGGAGG + Intergenic
1077204669 11:1336710-1336732 GCGGGGGGGCGGGGCGTGGAGGG + Intergenic
1077204681 11:1336732-1336754 GCGGGGGGGCGGGGCGTGGAGGG + Intergenic
1077204692 11:1336753-1336775 GGCGGGGGGCGGGGCGTGGAGGG + Intergenic
1077204720 11:1336805-1336827 GCGTGGGGGCGGGGCGTGGAGGG + Intergenic
1077204732 11:1336827-1336849 GCGGGGGGGCGGGGCGTGGAGGG + Intergenic
1079110296 11:17601590-17601612 ACCAGGGGGCGTGGCTGGGAGGG + Intronic
1080626366 11:34034212-34034234 GCCTGTGGGGGAGGCATGGATGG + Intergenic
1082787461 11:57324768-57324790 GGGCGGGGGAGGGGCATGGAAGG - Intronic
1082985970 11:59171909-59171931 TCCCGGGGCCGTGTCATGGCGGG + Intronic
1083303798 11:61752674-61752696 GCCCGGGGGCGCGGCATCGCCGG - Exonic
1083684719 11:64369364-64369386 GGCCGGGGGCGGGGCCTGGGTGG + Intronic
1083901871 11:65647189-65647211 GCCCCGGGGCTTGGCAAGGCCGG + Intronic
1085176661 11:74493746-74493768 GCCTGGGGGCGTGGCCTGAGGGG + Intergenic
1087985736 11:104677223-104677245 GACCAGGGGCGTTGCAGGGAGGG - Intergenic
1089712504 11:120325620-120325642 GCCCCGGGGCCTCGCAGGGACGG - Intronic
1090073979 11:123567715-123567737 GCAGGGGGGAGTGGGATGGATGG + Intronic
1091759421 12:3077310-3077332 GCCCGGGGGCGGAGCGGGGAGGG - Intergenic
1100632307 12:96400626-96400648 GGCCGGGGGCGGGGCCTGCAGGG + Intergenic
1102930211 12:116856342-116856364 GCCCGTGTGCGTGGCAGGGGCGG - Exonic
1103953391 12:124564349-124564371 GCCCAGGGGAGGGGCAAGGAGGG - Intronic
1104633703 12:130424995-130425017 GGCCGGGGGCATGCCGTGGAGGG + Intronic
1105799217 13:23889162-23889184 GCCCTGGGGCTTGACATTGAAGG + Exonic
1105830604 13:24160671-24160693 GGCTGGGGGCGTGGCCTGGTGGG + Intronic
1106130638 13:26936463-26936485 GCCCAGGGGCATGGCATCAAAGG + Intergenic
1107960603 13:45554821-45554843 GCCCTGGGTCCTGGCCTGGAGGG + Intronic
1112605404 13:100899924-100899946 GCCTGAGGGTGTGGAATGGAGGG + Intergenic
1113414882 13:110120875-110120897 GCCAGGGGGAGCGGCAGGGAAGG - Intergenic
1113517697 13:110915496-110915518 GGCCGGGGGCGGGGCCTGGCTGG + Intergenic
1116186521 14:41606644-41606666 GCGCGGGGGCGTTGCAGGAAGGG - Intergenic
1117956983 14:61130617-61130639 GCCCGGTGGCCTGGCATAGCCGG - Intergenic
1119319476 14:73721224-73721246 GCCTGGGGGCGTGGGAGGGAGGG - Intronic
1119381904 14:74234565-74234587 GCCTGGGGGAGTGGGAGGGAAGG - Intergenic
1119543597 14:75456445-75456467 GCCCGGGGGCGTGGCATGTAGGG + Intronic
1121779844 14:96615278-96615300 GGCGGGGTGGGTGGCATGGAGGG + Intergenic
1122287059 14:100658433-100658455 GCCCTGGGGAGTGGCAGTGAGGG + Intergenic
1122649901 14:103220583-103220605 GCCCGGGGGCGGGGCTGGGGTGG + Intergenic
1122741199 14:103872375-103872397 ACCCGGAGGCCTGGCCTGGAGGG - Intergenic
1122767476 14:104082099-104082121 CCCCGGGTGAGTGGCGTGGAGGG - Intergenic
1122834512 14:104424270-104424292 GCCCAGGGCAGTGGGATGGAAGG + Intergenic
1122880736 14:104689515-104689537 GGCCGGGGGCGGGGCCTGGGGGG - Intergenic
1124437429 15:29662670-29662692 GCTCGTGTGCGTGGCATGGATGG - Intergenic
1125718973 15:41836108-41836130 GCCCGGGGGCAGGGTATGGAGGG - Intronic
1127922482 15:63504441-63504463 ACCCGGGGGCGGGGCGGGGAGGG + Intergenic
1128699140 15:69791298-69791320 GCTGGGTGGTGTGGCATGGAAGG + Intergenic
1128812518 15:70583017-70583039 GCCCGGGGGGGGGGCATCTATGG + Intergenic
1130115310 15:81000977-81000999 GCCCGGGGGCGAGGCGCGGACGG + Exonic
1135827075 16:25738342-25738364 GCCAGGGTGCCTGGCATGTAAGG - Intronic
1136365435 16:29807108-29807130 GGCCGGGGGCGCGGCAGCGACGG - Exonic
1138316930 16:56078272-56078294 GCCCTGGGGCGTTCCATGTATGG - Intergenic
1142129781 16:88427403-88427425 GCCCTGGGGAGTGGGCTGGACGG - Intergenic
1142200622 16:88759630-88759652 GCCTGGGGTCATGGCAGGGAAGG - Intronic
1142406168 16:89891408-89891430 GCCCGGGGCCAGGGCAGGGATGG + Intronic
1142811948 17:2399646-2399668 GGCCGGGGGCGGGGCCTGGGCGG - Intronic
1142969191 17:3599948-3599970 CCACTGGGGCGTGGGATGGATGG + Intergenic
1144437286 17:15253223-15253245 GCCCTGGGGCATGGCACGCAGGG - Intronic
1144630784 17:16871137-16871159 GCCCAAGAGCATGGCATGGAGGG + Intergenic
1144650531 17:17004312-17004334 GCCCGAGAGCATGGCATGGAGGG - Intergenic
1147187431 17:38720292-38720314 GACCGGGGGCGGGGCCTGGAGGG - Intronic
1149265712 17:54925435-54925457 GCCCTGGGGCCTGGCTTGTAGGG - Intronic
1150797195 17:68247927-68247949 GCTCAGGGGCGTGGCATGGGTGG + Exonic
1151783427 17:76262868-76262890 GCACCTGGGCGGGGCATGGAGGG - Intergenic
1152379448 17:79934825-79934847 GCCTGGGGGCGGGGGCTGGAGGG - Exonic
1152736036 17:81997219-81997241 GCCCTGGGGTGGTGCATGGAGGG + Intronic
1152748131 17:82050578-82050600 GCACGAGGGCCTGGCATGGCTGG + Intronic
1153314909 18:3712032-3712054 CCCCGGTGGGGTGGCATGGGGGG + Intronic
1153907913 18:9679312-9679334 GGCCGGGGGCCTGGCAGGAATGG - Intergenic
1156149273 18:34223644-34223666 GCCCGGGGGCGAGGCGTCTAGGG - Intronic
1159798190 18:72868065-72868087 GCCGGGGGGCGGGGAAGGGAGGG + Intronic
1160133626 18:76252069-76252091 GCTTGGAGGCCTGGCATGGAAGG - Intergenic
1160317105 18:77858615-77858637 GCCCAGGGGTGTGGACTGGAAGG - Intergenic
1160540481 18:79617678-79617700 GCCCGGGGCCGCAGCATGGGGGG + Intergenic
1160725013 19:614024-614046 GGCCGGGGGCGTGGCCGGGGCGG + Intronic
1160919697 19:1513695-1513717 GCCCCGGGGCCCGGCAGGGAGGG - Intergenic
1160979995 19:1812352-1812374 GGCCGGGGGCGGGGCCTGGAGGG + Intergenic
1161821831 19:6534466-6534488 GCCGGGGGGCGGGGAATGGCGGG - Intronic
1161953221 19:7478957-7478979 GCCCGGGTGGGTGCCATGCACGG - Intronic
1162031852 19:7920887-7920909 GCCTGGGGGCGGGGCGTGGGCGG + Intronic
1162818922 19:13211248-13211270 GCCCGGGTGCGTGGCATGTGTGG - Intronic
1163664478 19:18596836-18596858 GAGCGGGGGCGGGGCCTGGAAGG + Intronic
1163711899 19:18852001-18852023 GCCACGGTGGGTGGCATGGAGGG - Intronic
1163782220 19:19256598-19256620 GCCTGGGGGTGGAGCATGGAGGG + Exonic
1163828813 19:19538196-19538218 GCCAGGGGGCGTGGCCTGAATGG + Intergenic
1165049978 19:33134951-33134973 GACCAGGGGTGTGGCCTGGAAGG - Intronic
1165425369 19:35742610-35742632 GCCCGGGAGCCTGGGAAGGATGG + Exonic
1166369106 19:42291573-42291595 ACCCGGGGGCGGGGCCTGCACGG - Exonic
1166869898 19:45864683-45864705 GACCGGGGACGAGGCATGGATGG + Intronic
1167268028 19:48493181-48493203 GAGCGGGGGCGGGGCCTGGAAGG - Intronic
1167454183 19:49590071-49590093 GCCCGGGGGCGGGGCGCAGAGGG + Intronic
1167586126 19:50376902-50376924 GTGCGGGGGCGGGGCATGAAGGG + Intronic
1168293765 19:55369351-55369373 GCCCCGGGGCGGGGCATGGTGGG + Intronic
1168366501 19:55792533-55792555 GCCCGTGGGCGTGGGGTGGGTGG - Intronic
1168599272 19:57705127-57705149 AGCTGGGGGCCTGGCATGGAAGG + Intronic
925615574 2:5741576-5741598 GGCAGGGCGCGTGGCATGGATGG - Intergenic
926159594 2:10478235-10478257 GCCCGGGGGGGTTCCATGGAAGG + Intergenic
927256195 2:21043278-21043300 GCCTGGGGGCGGGGGAGGGAAGG - Intronic
928314604 2:30235725-30235747 GCCAGGGTGGGTGCCATGGAGGG + Intronic
931881553 2:66575798-66575820 GCCCGGGGGCAAGGCCGGGAGGG + Intergenic
932434561 2:71695442-71695464 GCCCGGGAGCCTGGCCTGGTGGG - Intergenic
932725853 2:74179005-74179027 CCCCGGAGGCGTGGCGAGGATGG + Intergenic
933993554 2:87650990-87651012 GCCAGGGAGAGTGGCAAGGAAGG - Intergenic
936287104 2:111189350-111189372 GCCCTGGGGCCTGGGCTGGAGGG - Intergenic
936292710 2:111238803-111238825 GGCCGGGAGTGTGGCATGCAGGG + Intergenic
936300309 2:111299893-111299915 GCCAGGGAGAGTGGCAAGGAAGG + Intergenic
942628996 2:177935694-177935716 GCTCAGGGGCATGCCATGGAAGG + Intronic
947418617 2:229922155-229922177 GCCGGGAGGCGTGGGAGGGAGGG - Intronic
948636434 2:239340789-239340811 GCCAGGGTGCCTGGCCTGGAGGG - Intronic
948823085 2:240560291-240560313 GCGCGGAGGCGTGGCTTGGCCGG - Exonic
948974668 2:241457006-241457028 ACCCTGGGGCGGGGCAGGGAAGG + Intronic
1169235622 20:3927711-3927733 GACCGGGGGCCTGGGAGGGAAGG + Intronic
1169252452 20:4071081-4071103 GCCCAGGGGAGTTGCAGGGATGG + Intronic
1170647988 20:18213634-18213656 GCCCGGCTGCGTGGCAGGGAGGG - Intergenic
1171115545 20:22522074-22522096 GCCCGGGGGCGGGGAGTGGGGGG - Intergenic
1171278643 20:23879015-23879037 GCCCAGGGGCGTGACTTGGGAGG + Intronic
1172525973 20:35600866-35600888 GCCGGGGGGCGAGCCATAGAGGG + Intergenic
1173858769 20:46268534-46268556 GCCCGGGGTGGTGGGAGGGAGGG - Intronic
1174181807 20:48679800-48679822 GCTGGGGGGCGTGGCTGGGAGGG - Intronic
1175108593 20:56630682-56630704 TCCCGAGGGCGTGGAAGGGAGGG + Intronic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1176019786 20:62956765-62956787 GCCCGAGTGCCAGGCATGGACGG + Exonic
1176143206 20:63554084-63554106 GCCCGGGGGCGGGGCGGGGGTGG - Exonic
1176286695 21:5022464-5022486 GGCCGGGGGCGGGGCGGGGACGG + Intergenic
1179446088 21:41431758-41431780 GCCCCGGGGCCCGGCCTGGAGGG + Intronic
1179501214 21:41810112-41810134 GCCCGCTGGCGGGGCACGGAGGG + Intronic
1179775169 21:43657779-43657801 GCATGGGAGCGTGGGATGGATGG - Intronic
1179783861 21:43719030-43719052 GCCCGGGGGCGGGGCCTGCGTGG + Intergenic
1179870486 21:44241011-44241033 GGCCGGGGGCGGGGCGGGGACGG - Intergenic
1179934400 21:44592959-44592981 GCCCTGGGCCATGGCATGGTGGG + Intronic
1180031435 21:45211123-45211145 GCCCTGGGGAGTGGGCTGGAAGG + Intronic
1180216181 21:46324795-46324817 GGCCGGGGGCGTGGCGCGGGTGG + Intronic
1180800823 22:18631105-18631127 GGCCGGGGGCCAGGCATGGTGGG - Intergenic
1180852056 22:19026662-19026684 GGCCGGGGGCCAGGCATGGTGGG - Intergenic
1180939176 22:19645612-19645634 GCCACAGGTCGTGGCATGGAGGG - Intergenic
1180996937 22:19970446-19970468 GCCCAGGGAGGTGGCAGGGAAGG - Exonic
1181220894 22:21364157-21364179 GGCCGGGGGCCAGGCATGGTGGG + Intergenic
1181516326 22:23415613-23415635 GTCCGGGGGAGTGGGAGGGATGG - Intergenic
1183162348 22:36123355-36123377 GCCGGGGTGCCTGGTATGGAGGG + Intergenic
1183560701 22:38570351-38570373 ACCAGAGGGCGTGGCCTGGAGGG + Intergenic
1184415321 22:44348835-44348857 GGCCGGGGTCGTGGCATGCGTGG - Intergenic
1184643908 22:45885903-45885925 GCCTGGTGGCGAGGCCTGGAGGG + Intergenic
1185202764 22:49518174-49518196 GCCTGGGGGTGTGGCACGGTGGG - Intronic
1185289284 22:50015695-50015717 GCCTGGGGGCGTGGCCTTGAGGG - Intronic
1185310948 22:50153918-50153940 TCCGGGGCCCGTGGCATGGAAGG - Intronic
1185337425 22:50276806-50276828 GCATGGGGGCCTGGCCTGGAGGG + Intronic
950282465 3:11719679-11719701 GACCGAGGGCGTGGCCTGGCTGG - Intronic
950578857 3:13850137-13850159 GCCCAGGGGCGGGGCAGGAATGG + Intronic
961309950 3:125990365-125990387 GGGCGGGGGCGAGGCATGGCTGG - Intergenic
961446221 3:126983008-126983030 GCCCGGGGGCGGGGCGGGGGCGG - Intergenic
961563230 3:127745871-127745893 GCACAGGGGCGGGGCATGGAAGG + Intronic
961827559 3:129606813-129606835 GCCCGGGGGCGGGGCGGGGGCGG + Exonic
962551331 3:136495535-136495557 GCCAGGTGTGGTGGCATGGATGG + Intronic
967840785 3:194003214-194003236 GCCCGCGGGCGGGGCAGGAAGGG + Intergenic
968626562 4:1628718-1628740 GCATGGGGGAGTGGCATGGGGGG + Intronic
968626584 4:1628764-1628786 GCATGGGGGAGTGGCATGGGGGG + Intronic
968702989 4:2065433-2065455 GGCGGGGGGGGTGGCCTGGAAGG + Exonic
969615860 4:8252309-8252331 GCCCAGGGACTTGGGATGGAGGG - Intergenic
982089402 4:151867402-151867424 GCCCAGGGGCTTGGCATTGTGGG + Intergenic
984526772 4:180867018-180867040 GCCTGGGTGGGTGCCATGGACGG - Intergenic
985649749 5:1101950-1101972 GCTGGGGGGCTTGGCAGGGAGGG - Intronic
986258161 5:6119137-6119159 GCCCTGGAGCGTGGTGTGGAGGG + Intergenic
988421873 5:31015573-31015595 GGGCGGGGGCGAGGCATGGAGGG + Intergenic
989980081 5:50633161-50633183 GCCCGAGGGCTTGGCGTCGACGG - Intergenic
995240556 5:109881475-109881497 GCCCGGGGGCATCCCATGGAGGG + Intergenic
996443057 5:123512753-123512775 GCCCGGAGGCGTGGGCAGGAGGG + Intronic
997627328 5:135339883-135339905 GCCCGGGGGCCTGGAGTGGGAGG - Intronic
998157896 5:139796532-139796554 GCACGGGGGCGTGGCAGTCAGGG + Intronic
1001042889 5:168349455-168349477 GCCCTGGAGAGTGGGATGGAAGG - Intronic
1001830082 5:174778850-174778872 GGGCGGGGGGGTGGCAAGGAAGG + Intergenic
1002098342 5:176845123-176845145 TCCCCGGGGCAGGGCATGGAGGG - Intronic
1002419676 5:179139171-179139193 CCCGGGGGGGCTGGCATGGAGGG - Intronic
1002439678 5:179257815-179257837 GCCCGGGGCAGTGGCCGGGATGG - Intronic
1002817539 6:693892-693914 GCCCGGGGTCGTGGGATGCTGGG + Intergenic
1007582177 6:42966216-42966238 GCCAGGGGGCCTGGAAGGGATGG - Intronic
1008932449 6:56954875-56954897 GCCCGGGGGCTGCGCACGGACGG - Intergenic
1010209884 6:73354329-73354351 GGCCGGGGGCGGGGCCTGGCCGG - Intergenic
1015402138 6:132798653-132798675 GGCCGGGGGCGGGGCAGGGGTGG + Intergenic
1018085027 6:160294096-160294118 GCCAGGGGGCGTGGCCTGGAGGG + Intergenic
1019462793 7:1169995-1170017 GCAAGGGGGCGTGGCCGGGAGGG - Intergenic
1019464760 7:1181555-1181577 CCGAGGGGGCGTGGCAGGGAGGG + Intergenic
1019897114 7:3991213-3991235 GCCTGGGGGCCTGGCACTGAGGG - Intronic
1020244408 7:6419722-6419744 GCCAGGGGGCTTGGCCTGGGTGG - Intronic
1021409407 7:20312786-20312808 GCCAAGGGGAGTGTCATGGATGG + Intergenic
1023970446 7:44986920-44986942 GCCTGACGGCGTGGCCTGGAGGG + Intergenic
1024231873 7:47369006-47369028 GACCTGGGCCTTGGCATGGACGG - Exonic
1024993732 7:55255228-55255250 GCCGGTGGGCGAGGCCTGGATGG - Intronic
1025988147 7:66474045-66474067 GGCTGGGGCCGTGGCATGAAGGG - Intergenic
1027190804 7:75994550-75994572 GCCCGGGGGCGGGGGCTGCATGG + Exonic
1029283776 7:99452736-99452758 GCCCCTGGGGCTGGCATGGAGGG + Intronic
1029524763 7:101087943-101087965 GCCCGGAGGCCGGGCCTGGAGGG + Exonic
1035133752 7:156679234-156679256 GGCCTGGGGCGTGGTGTGGAGGG - Exonic
1035153404 7:156893216-156893238 GGGCGGGGGCGGGGCAGGGAGGG + Exonic
1035224604 7:157426444-157426466 GCCCAGGGGAGCAGCATGGAGGG - Intergenic
1038647381 8:29372979-29373001 GCCCAGGGGTGTGGCAAGCAGGG + Intergenic
1039476442 8:37841610-37841632 GGCCCGGGGCGGGGCATGGGGGG - Exonic
1039936873 8:42052529-42052551 GCCCGAGGGCGGGGCCTGGGGGG + Intergenic
1040848642 8:51874330-51874352 CCCCGGGGGCGGGGGATGGGTGG - Intronic
1048072878 8:131040262-131040284 GGCCGGGGGCGTCGGGTGGATGG + Exonic
1049371072 8:142267651-142267673 GCCGGGGGGAGTGGCAGGGATGG - Intronic
1049406158 8:142452684-142452706 GCCGCGGGGCCTGGCATGAAGGG + Intronic
1053415925 9:37946741-37946763 GGCTGGGGGCCTGGCCTGGAGGG - Intronic
1058826621 9:108781185-108781207 GCCGGGGGACGTGGCAGGAAAGG + Intergenic
1059145467 9:111896340-111896362 GCCCAGGAACGTGGCCTGGAGGG + Intergenic
1061196241 9:129108623-129108645 GCCGGGTGGCCTGGCATGGAGGG + Intronic
1061295615 9:129675316-129675338 GCCCAGGGGCGTGGAATGCAGGG + Intronic
1061765161 9:132877378-132877400 CCCCAGGGGCATGGCATGGAGGG - Intronic
1062628646 9:137454051-137454073 GGCTGGGGGCGTGGCTGGGAGGG + Intronic
1062628663 9:137454089-137454111 GGCTGGGGGCGTGGCTGGGAGGG + Intronic
1062628680 9:137454127-137454149 GGCTGGGGGCGTGGCTGGGAGGG + Intronic
1062628697 9:137454165-137454187 GGCTGGGGGCGTGGCTGGGAGGG + Intronic
1062628714 9:137454203-137454225 GGCTGGGGGCGTGGCTGGGAGGG + Intronic
1062656112 9:137605337-137605359 GCCGGGGGGCGGGGCAGGGGTGG + Intergenic
1062697753 9:137884164-137884186 GCTTGGGGGTGTCGCATGGAAGG + Intronic
1185504030 X:619167-619189 GCCCCGGGGCGAGGCAGGGGAGG - Intergenic
1190141581 X:47850588-47850610 GACCAGGGGCGTTGCAGGGAGGG + Intronic
1198871057 X:141177263-141177285 GCGTGGGGGCGTGGCCGGGATGG + Intergenic
1199717171 X:150515184-150515206 TGCCTGGGGCCTGGCATGGATGG - Intergenic
1200068318 X:153515536-153515558 GCCCTTGGGCCTGGGATGGAAGG + Intergenic
1200073812 X:153541562-153541584 GCCCGGGGGCCTGGGCTGGAAGG + Intronic