ID: 924954681

View in Genome Browser
Species Human (GRCh38)
Location 1:248914927-248914949
Sequence GCACACAGTCCTGACACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924954681_924954685 2 Left 924954681 1:248914927-248914949 CCTTCAGTGTCAGGACTGTGTGC No data
Right 924954685 1:248914952-248914974 GTGGTTCTTTCTCTCTGCCTGGG No data
924954681_924954688 29 Left 924954681 1:248914927-248914949 CCTTCAGTGTCAGGACTGTGTGC No data
Right 924954688 1:248914979-248915001 CTTGTCTCCAGCTGTCTGTAGGG No data
924954681_924954687 28 Left 924954681 1:248914927-248914949 CCTTCAGTGTCAGGACTGTGTGC No data
Right 924954687 1:248914978-248915000 TCTTGTCTCCAGCTGTCTGTAGG 0: 1
1: 0
2: 2
3: 25
4: 316
924954681_924954684 1 Left 924954681 1:248914927-248914949 CCTTCAGTGTCAGGACTGTGTGC No data
Right 924954684 1:248914951-248914973 TGTGGTTCTTTCTCTCTGCCTGG 0: 1
1: 0
2: 5
3: 37
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924954681 Original CRISPR GCACACAGTCCTGACACTGA AGG (reversed) Intronic
No off target data available for this crispr