ID: 924955045

View in Genome Browser
Species Human (GRCh38)
Location 1:248917947-248917969
Sequence CTGTATCAGGAGAAGGTGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924955040_924955045 -8 Left 924955040 1:248917932-248917954 CCATCACTGGTGAAGCTGTATCA 0: 1
1: 0
2: 1
3: 10
4: 91
Right 924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG 0: 1
1: 0
2: 1
3: 23
4: 357
924955038_924955045 -1 Left 924955038 1:248917925-248917947 CCACCAGCCATCACTGGTGAAGC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG 0: 1
1: 0
2: 1
3: 23
4: 357
924955039_924955045 -4 Left 924955039 1:248917928-248917950 CCAGCCATCACTGGTGAAGCTGT 0: 1
1: 0
2: 0
3: 5
4: 139
Right 924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG 0: 1
1: 0
2: 1
3: 23
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924955045 Original CRISPR CTGTATCAGGAGAAGGTGGG TGG Exonic
901327461 1:8376584-8376606 CTGTATCAGAAGCTGGTGGGTGG - Intronic
902236890 1:15063412-15063434 CTGCTTCAGGAGATGGGGGGTGG + Intronic
902316522 1:15623963-15623985 CTGAAGCAGGAGAACCTGGGAGG + Intronic
903050020 1:20593816-20593838 CTGTGTGAGGCCAAGGTGGGAGG - Intronic
903196108 1:21689499-21689521 CTGTATCTGGAGAAGAATGGGGG + Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903813777 1:26049767-26049789 CTGAGTCTGGAGATGGTGGGAGG - Intergenic
904561112 1:31397830-31397852 CTGAATCTGGAGGAAGTGGGAGG - Intergenic
905308735 1:37035313-37035335 CTTTCTCAGGAGAATGAGGGAGG - Intergenic
905810985 1:40913079-40913101 CTTTGCCAGGACAAGGTGGGCGG - Intergenic
906674730 1:47685092-47685114 TTGTAAAAGGAGTAGGTGGGAGG + Intergenic
906777505 1:48543203-48543225 CTGACTCAGGAGTAGGTGAGGGG + Intronic
908491310 1:64646723-64646745 CTGTCTCAAAAAAAGGTGGGGGG + Intronic
908673644 1:66576888-66576910 CTGCTTGGGGAGAAGGTGGGAGG - Intronic
909150612 1:71998580-71998602 GTGTAGCAAGAGAAGGTAGGTGG - Intronic
911135875 1:94439541-94439563 CTGATACAGGAGAACGTGGGAGG + Intronic
911634549 1:100219494-100219516 CTCTAGCAGGCCAAGGTGGGTGG + Intronic
912401271 1:109395829-109395851 CTGTGGCAGGCTAAGGTGGGTGG + Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913017464 1:114753672-114753694 CTGTGGCAGGCCAAGGTGGGAGG + Intronic
914732920 1:150388159-150388181 CTATATGAGGCCAAGGTGGGTGG - Intronic
916312320 1:163410770-163410792 CTTTATGCAGAGAAGGTGGGTGG + Intergenic
916531895 1:165664390-165664412 GTATATCAGGAGAAGGTTTGAGG - Intronic
919806973 1:201386073-201386095 CTGGATGAGGATATGGTGGGGGG + Intronic
919882644 1:201910935-201910957 CTATATCAGTAGTAAGTGGGAGG + Intronic
920536803 1:206742743-206742765 AGGTAGCAGGAGTAGGTGGGTGG + Intergenic
922342415 1:224668658-224668680 CTGGACCAGAAGAAGGAGGGAGG + Intronic
924489086 1:244517526-244517548 CTTTAGGAGGAGGAGGTGGGTGG + Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1062773631 10:126171-126193 CTTTATGAGGCCAAGGTGGGTGG + Intergenic
1063559477 10:7113058-7113080 TGGCATCAGGAGAAGCTGGGAGG - Intergenic
1064222539 10:13454360-13454382 CTTTATGAGGCTAAGGTGGGGGG + Intronic
1065943001 10:30581989-30582011 CTATAGCAGGAGGATGTGGGAGG - Intergenic
1066252765 10:33650320-33650342 CTGGAGCAGGAGGAAGTGGGTGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1066593781 10:37025739-37025761 CTGTATGAGGAGAATTTAGGTGG + Intergenic
1067019123 10:42780041-42780063 CTGGAGCAGGAAAAGGTGGTGGG + Intergenic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1068464750 10:57375482-57375504 CTGTATCATGAACTGGTGGGAGG + Intergenic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070695622 10:78561194-78561216 CTCTGTGAGGAAAAGGTGGGGGG + Intergenic
1070871488 10:79757796-79757818 TTGTTTCAGGGGAAGGAGGGAGG + Intergenic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1073482734 10:103797276-103797298 CTGTGAGAGAAGAAGGTGGGTGG + Intronic
1074088034 10:110223480-110223502 CTGTGTCAGGAGAACCCGGGAGG + Intronic
1074371784 10:112906305-112906327 CTTTGTCAGGCCAAGGTGGGCGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1077719850 11:4617046-4617068 CTGAAACAGGAGGAAGTGGGGGG + Intergenic
1077820805 11:5738323-5738345 CTGTAGCTGTAGCAGGTGGGTGG - Intronic
1078306564 11:10193968-10193990 CAGGATCAGGAGAAGGTCTGGGG - Exonic
1078746036 11:14115072-14115094 CTGTAAGAGGCAAAGGTGGGAGG - Intronic
1078795513 11:14588351-14588373 CTCTAACAGGAGTAGGTGGAGGG + Intronic
1078906831 11:15695558-15695580 CCATAGCAGGAGAAGGAGGGAGG + Intergenic
1079239826 11:18714525-18714547 CTGAATGACGAGAAGGTGGAGGG - Exonic
1081092782 11:38893756-38893778 GTTTATCAGGAGAAGGTGACTGG + Intergenic
1082224512 11:49688412-49688434 CTGTAGGAGGCCAAGGTGGGTGG + Intergenic
1082785304 11:57313354-57313376 CAGGACCAGGAGAAGCTGGGGGG - Exonic
1083680203 11:64348287-64348309 TTGGAGCAGGAGAAGGTGGCTGG + Intronic
1084509084 11:69591898-69591920 CTGTTTCAGGAGGAGATGGTGGG - Intergenic
1084576686 11:69993136-69993158 CTGTCTCAGGAGGGGGTGGCTGG - Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084857015 11:71995945-71995967 CTGAATGCAGAGAAGGTGGGAGG - Intronic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1086311112 11:85537245-85537267 CTCTCTCAGGAGGATGTGGGTGG + Intronic
1086969754 11:93067410-93067432 CTGCCTCAGGAGAGGATGGGGGG + Intergenic
1088180606 11:107104657-107104679 CTGGAGCAGGAGAAAGGGGGAGG + Intergenic
1088369904 11:109077700-109077722 CTCTTTCATGAGATGGTGGGAGG - Intergenic
1088655536 11:111995840-111995862 CTCAATCAGGGGTAGGTGGGAGG - Intronic
1089088105 11:115841167-115841189 CTTTGTCAGGCCAAGGTGGGAGG - Intergenic
1089341631 11:117761910-117761932 CAGTATCATTATAAGGTGGGTGG - Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1095715733 12:45344142-45344164 CTGTATCAGGAGAAAGTCTTAGG + Intronic
1096612058 12:52808678-52808700 CTGTACCAGACCAAGGTGGGTGG - Exonic
1096793045 12:54056992-54057014 GTTTGTTAGGAGAAGGTGGGAGG + Intergenic
1098305924 12:69102619-69102641 CTTTATGAGGCCAAGGTGGGTGG + Intergenic
1098952410 12:76654681-76654703 CTTTAGGAGGACAAGGTGGGCGG - Intergenic
1100682576 12:96943800-96943822 GTTTATCAGTAGAAAGTGGGTGG + Intronic
1101315085 12:103621631-103621653 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1101793372 12:107951181-107951203 CTCAAGCAGGAGCAGGTGGGTGG - Intergenic
1102466704 12:113134660-113134682 CTGAATCAGCAGAATATGGGGGG - Intronic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1102968329 12:117146448-117146470 GGCAATCAGGAGAAGGTGGGTGG + Intronic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103900456 12:124301117-124301139 GTATGTCAGGACAAGGTGGGAGG + Intronic
1105703174 13:22948963-22948985 CGGTGTCAGGAGCAGGTGAGGGG - Intergenic
1106531693 13:30599223-30599245 CTTTATGAGGCCAAGGTGGGCGG + Intronic
1107163803 13:37262702-37262724 CAGAATCAGGAGGAGGTGAGAGG + Intergenic
1107629985 13:42333607-42333629 CTGTGTCAGGAGACGGGGCGGGG - Intergenic
1109247625 13:59975976-59975998 GGGTGACAGGAGAAGGTGGGCGG - Intronic
1111296927 13:86291231-86291253 CTGTAGCAGGAGTAAGAGGGTGG - Intergenic
1111713158 13:91843684-91843706 CTGTATGAAGAGTAGGTGGCTGG + Intronic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1112370179 13:98787195-98787217 CCGTATCAGGAGGTGGTTGGAGG - Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113406520 13:110045969-110045991 GTGATGCAGGAGAAGGTGGGAGG - Intergenic
1113582916 13:111441272-111441294 ATGTACCAGGAGGAGGTGAGGGG - Intergenic
1115027780 14:28764415-28764437 CTGTAAGAGGAGAAATTGGGAGG + Intergenic
1117508309 14:56424233-56424255 CTGGATCAAGGGAAGGTGAGGGG + Intergenic
1118302218 14:64625943-64625965 CTGGATCTGGAGCAGGAGGGAGG + Intergenic
1118489960 14:66249333-66249355 ATTCTTCAGGAGAAGGTGGGAGG - Intergenic
1119391776 14:74295863-74295885 GTGCATCAGGAGAAGCTGGAGGG - Exonic
1119614650 14:76091157-76091179 CTGTCACAGGAAAAGGTGGGAGG + Intergenic
1120520185 14:85518497-85518519 CTGAATCAGAAGAAGGTTGCAGG + Intergenic
1122131890 14:99609059-99609081 CTGAAGCAGGAGGAAGTGGGTGG - Intergenic
1123147471 14:106146889-106146911 CTGTCTCAGGAGCAGGGGTGAGG + Intergenic
1123798180 15:23794658-23794680 CTGTATCTGGTTAAGGTGTGAGG + Intergenic
1124593787 15:31077347-31077369 CTGGAGCAGAAGGAGGTGGGAGG + Intronic
1124828753 15:33127078-33127100 CTGTATCAGGAGCTGGTTGGGGG + Intronic
1124873459 15:33566860-33566882 CAGTATCAAAAGGAGGTGGGTGG - Intronic
1125501028 15:40240386-40240408 GTGTGTCAGGAGGAGGGGGGAGG + Intronic
1125555342 15:40580116-40580138 GTGTGACAGGAGAAGGAGGGAGG + Intergenic
1126160191 15:45604805-45604827 TTATGTCAGGAGAAGATGGGAGG - Intronic
1127823930 15:62686632-62686654 CTGTTTCAGGAGAAGATGAAAGG + Exonic
1128214710 15:65926298-65926320 CTGTGGCATGAGAAGGTTGGTGG + Intronic
1128268476 15:66288322-66288344 CTTTAGGAGGACAAGGTGGGAGG + Intergenic
1128552969 15:68609991-68610013 TTTTATCAAGAGAAGGAGGGTGG - Intronic
1128568513 15:68716829-68716851 ATGTAGCAGGAGATGGGGGGAGG + Intronic
1128571754 15:68738692-68738714 CTTTATGAGGCCAAGGTGGGAGG - Intergenic
1128892267 15:71342036-71342058 CTGTAACAGGAGATGGGGAGGGG + Intronic
1130550935 15:84889467-84889489 CCCTCTCAGGAGGAGGTGGGAGG + Intronic
1131678877 15:94700961-94700983 CTGTGTCAATAGAGGGTGGGTGG + Intergenic
1132474767 16:128927-128949 CTGTATCTGGAAAACATGGGTGG + Intronic
1132532258 16:458274-458296 CTGTTTCAGGAAAAGGATGGGGG - Intronic
1132749326 16:1450259-1450281 CTGGACCAGGCGAAGGTAGGGGG - Intronic
1132931816 16:2462544-2462566 CTGTATCAGGAGGAGTGTGGAGG + Intronic
1132933783 16:2471278-2471300 CTGTGCCAGGAGGGGGTGGGGGG - Intergenic
1132965209 16:2649945-2649967 CTTTAGCAAGACAAGGTGGGAGG + Intergenic
1133170591 16:3980486-3980508 CTGCCTCAGGAGAGGCTGGGCGG + Intronic
1134539019 16:15049270-15049292 CTGTAGGAGGCCAAGGTGGGTGG - Intronic
1134661042 16:15984857-15984879 CTTTGGCAGGTGAAGGTGGGAGG + Intronic
1138053622 16:53809696-53809718 CTGTAGGAGGCCAAGGTGGGAGG + Intronic
1138542761 16:57698441-57698463 CTTTAGAAGGAAAAGGTGGGAGG + Intronic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1139669162 16:68480011-68480033 TTTTGGCAGGAGAAGGTGGGAGG + Intergenic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1140105650 16:71957552-71957574 CTTTGGGAGGAGAAGGTGGGAGG + Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141436081 16:84000701-84000723 CTGCAACAGGAGATGGTCGGGGG - Intronic
1142125966 16:88410896-88410918 CTGGAGGAGGAGGAGGTGGGAGG - Intergenic
1142669378 17:1480698-1480720 CTGTACCTGGTGAAGGTGAGTGG - Exonic
1144429124 17:15174352-15174374 CTGGACCAGGAGAAGGTTGTAGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1144675428 17:17158619-17158641 CTGGCTCAGGAGCGGGTGGGCGG + Exonic
1144946729 17:18973193-18973215 CTGCATTGGGAGGAGGTGGGAGG - Intronic
1146022258 17:29290011-29290033 CTGAGTCAGGAGAATCTGGGAGG - Intronic
1146688441 17:34856971-34856993 CTCACCCAGGAGAAGGTGGGGGG + Intergenic
1146912646 17:36658323-36658345 TTCTCTCAGGAGAGGGTGGGCGG + Intergenic
1151504330 17:74516622-74516644 CTGCCTCAGGAGAGGGTGTGAGG + Intergenic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1154308985 18:13253193-13253215 AGGTGACAGGAGAAGGTGGGAGG + Intronic
1156564151 18:38164508-38164530 CTGTCTCAGGAGGTGGTGGTGGG + Intergenic
1156584780 18:38420142-38420164 CTGGGTCAGGAGGAGGTTGGTGG + Intergenic
1157009733 18:43632452-43632474 CTGTATTAGGAGAAAGTCTGGGG - Intergenic
1157048363 18:44130390-44130412 CTGAATCAGGAAACAGTGGGGGG + Intergenic
1157208033 18:45717218-45717240 CTCTTTGAGGAGATGGTGGGGGG - Intergenic
1157385505 18:47256832-47256854 CTATATGGGGAGGAGGTGGGTGG - Intergenic
1158702169 18:59758012-59758034 CTGGGTGAGGAGAAGGTTGGAGG - Intergenic
1159508814 18:69369370-69369392 GGGTATCAGAGGAAGGTGGGGGG + Intergenic
1159580420 18:70229498-70229520 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
1160665328 19:325487-325509 CTGTGGCTGGAGGAGGTGGGAGG - Intronic
1160723602 19:608168-608190 CAGTACCAGGAGAAGGTCTGAGG + Exonic
1161043276 19:2121375-2121397 CTGTCTCAGGAGCAGGTGTTGGG - Intronic
1161114291 19:2488257-2488279 CTGCATCTGGAGAAGGGGTGGGG + Intergenic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1162809319 19:13154677-13154699 CTGAATCACGAGAATGTGGAGGG + Exonic
1163147657 19:15392075-15392097 CTTTAGGAGGTGAAGGTGGGAGG - Intronic
1163468752 19:17484923-17484945 CTGAAACAGGGGCAGGTGGGTGG + Intronic
1165375112 19:35436388-35436410 TGCTCTCAGGAGAAGGTGGGAGG - Intergenic
1165545142 19:36528811-36528833 CAGGATCAGGAGGAGGTTGGAGG + Intergenic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166646113 19:44533019-44533041 CTGGCTTAGGAGAAGGTGGGTGG - Intergenic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167593708 19:50417083-50417105 CTGTATCAGAAGGAGGTGAGAGG + Exonic
1167670129 19:50847258-50847280 CTTTATCAGGCCAAGGCGGGCGG - Intergenic
925210942 2:2045479-2045501 CAGTTTCATGAGCAGGTGGGTGG - Intronic
926175974 2:10592480-10592502 ATGTCTCAGGAGAAGGGAGGGGG + Intronic
927433000 2:23042681-23042703 CTGCATGAGGAGGTGGTGGGTGG - Intergenic
927455207 2:23242859-23242881 CAGGAGCAGGAGAAGGTTGGGGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
928512232 2:32012188-32012210 CTGAAGTTGGAGAAGGTGGGAGG - Intronic
928629754 2:33178982-33179004 CTGTAGGAGGCCAAGGTGGGAGG - Intronic
934308568 2:91844382-91844404 CTGTAGAAAGAGAAGGTGAGGGG - Intergenic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
937208033 2:120249274-120249296 CTTTAGGAGGTGAAGGTGGGTGG - Intronic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938292619 2:130158176-130158198 CAGGATGAGGAGCAGGTGGGAGG - Intronic
939223706 2:139337932-139337954 CTATCTCAGGAGAAGGAAGGTGG + Intergenic
939385106 2:141485940-141485962 CTGAATCATGAGGAGTTGGGAGG + Intronic
939855144 2:147349786-147349808 CTGTAGGAGGCCAAGGTGGGTGG + Intergenic
939872875 2:147544450-147544472 TTGTAGCAGGAGAAAGGGGGTGG - Intergenic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
940866308 2:158820813-158820835 CTTTATAAGGAGAAGAAGGGAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942175974 2:173335075-173335097 CTGGAGCAGGCCAAGGTGGGAGG - Intergenic
942336799 2:174897034-174897056 ATCTATCAATAGAAGGTGGGAGG - Intronic
943539086 2:189189234-189189256 CTCTATCAGGAGAAGAAGAGAGG - Intergenic
943580955 2:189683072-189683094 CTGTATCCGTACAGGGTGGGAGG - Intronic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
947999060 2:234552826-234552848 CTTTATGAGGCCAAGGTGGGTGG + Intergenic
1170116160 20:12862413-12862435 CTGTAGCAGGCAAAGGTGGAAGG - Intergenic
1171467856 20:25343703-25343725 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1172248691 20:33463728-33463750 CTTTGGCAGGCGAAGGTGGGAGG + Intergenic
1173445039 20:43110109-43110131 CTGTATCAGGAGAAGGCCTCAGG + Intronic
1174241375 20:49138039-49138061 CTTTTTAAGGACAAGGTGGGTGG + Intronic
1175884532 20:62281706-62281728 CTGTAACAGGAGAAGCGCGGTGG - Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1175997701 20:62818855-62818877 CTGGAACTGAAGAAGGTGGGAGG - Intronic
1179386581 21:40948575-40948597 CGGTATCATGAGAACCTGGGAGG + Intergenic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1181376132 22:22459711-22459733 CTTTTTGAGGAGTAGGTGGGTGG - Intergenic
1181683744 22:24514479-24514501 CAGGATCAGGAGGAGGTGGAAGG + Intronic
1182041181 22:27240014-27240036 CTTAATCAGAAGAAGGTGAGAGG - Intergenic
1182689716 22:32150559-32150581 CTGGATCATGTGCAGGTGGGCGG + Intronic
1183066784 22:35368874-35368896 CAGTTACAGGAGGAGGTGGGAGG - Intergenic
1183098509 22:35569026-35569048 CTGCATGCGGGGAAGGTGGGAGG + Intergenic
1184706081 22:46214525-46214547 GTGGATCAGGAGATGTTGGGGGG + Intronic
1185376585 22:50485419-50485441 CTGGGTCAGGAGAAGGTGTCTGG - Exonic
949791617 3:7798665-7798687 CTGTTTCAGGGGAACGTGAGAGG + Intergenic
950014706 3:9747461-9747483 CAGTCTCAGGGGAAGCTGGGTGG + Exonic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
951186558 3:19720669-19720691 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
951223284 3:20092471-20092493 CTTTAGGAGGACAAGGTGGGTGG - Intronic
953626923 3:44579350-44579372 CTGAATCAGGAGCGGGTGGGCGG - Intronic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954366055 3:50146793-50146815 CTGTCTCAGGAGAGTGGGGGAGG + Intergenic
954687116 3:52377021-52377043 CTGTCTCAGGAGAGTGTGGTTGG - Intronic
954955199 3:54512673-54512695 ATGCATCATGAGCAGGTGGGTGG - Intronic
955472638 3:59301834-59301856 TTGAATCAGGAGGAAGTGGGAGG + Intergenic
956188454 3:66584715-66584737 TAGTAACAGGAGAAGCTGGGGGG - Intergenic
956330451 3:68101160-68101182 CTGTATCAGAGGATGGAGGGTGG - Intronic
956469062 3:69546086-69546108 CTTTAGGAGGACAAGGTGGGAGG - Intergenic
957618575 3:82566179-82566201 ATTTATCAGGAGAAGGTGTTTGG - Intergenic
959531592 3:107439993-107440015 CTGTATGAGGAGCAGGTTTGCGG + Intergenic
962346778 3:134624559-134624581 ATGTCTCAGGTGCAGGTGGGAGG - Intronic
963891877 3:150644877-150644899 CTGTGGCAGGCCAAGGTGGGTGG + Intergenic
964838893 3:160972009-160972031 CTTTAACAGGCCAAGGTGGGAGG - Intronic
964918780 3:161870601-161870623 CTGTATTAGGATAAGGTAGAAGG - Intergenic
966207560 3:177420508-177420530 ATGTAGCAGAAGAAGGCGGGAGG - Intergenic
967635818 3:191801679-191801701 CTGTGGCAGTAGAAGTTGGGTGG - Intergenic
967951845 3:194847397-194847419 CTGTACCAGGAGAGAGTGGCTGG + Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968188933 3:196653454-196653476 CTGGCCCAGGAGAAGATGGGAGG + Intronic
969167478 4:5329498-5329520 CTCTAGCAGGTGAAGGTGGGTGG - Intronic
969265620 4:6062340-6062362 CTGCTCCAGGAGCAGGTGGGAGG - Exonic
969295642 4:6269538-6269560 CTGTTACAGGAGAAGGCGAGCGG + Intergenic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
969631791 4:8343254-8343276 CTGGATGAGGAGAAGCAGGGAGG + Intergenic
969666819 4:8562603-8562625 CTAAATCAGGAGAAGATGGAAGG + Intronic
969883684 4:10196638-10196660 CTCTGTCAGCAGAAGGTGGGGGG + Intergenic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
971912152 4:32808716-32808738 CTTTATGAGGCCAAGGTGGGAGG + Intergenic
972830034 4:42803791-42803813 CTGGAGCAGGAGAAAGTGGGGGG + Intergenic
973759917 4:54106126-54106148 CTGTGTTTGGAGAAGATGGGAGG - Intronic
977172390 4:93779499-93779521 CTTTCTCAGGAGAAGCTGGGTGG - Intergenic
977341045 4:95758457-95758479 GTGTATCAGGAAAAGGTTTGAGG - Intergenic
978737654 4:112102406-112102428 CTTTATAAAGATAAGGTGGGGGG + Intergenic
979475874 4:121157086-121157108 CTGCAGCGGGAGGAGGTGGGCGG - Exonic
979994804 4:127418034-127418056 CTGAATCTGGGGAATGTGGGAGG - Intergenic
981426661 4:144611332-144611354 CTGGAGCAGGAGGAAGTGGGGGG - Intergenic
982266907 4:153546132-153546154 CTTTAAGAGGACAAGGTGGGAGG - Intronic
982463738 4:155704495-155704517 CTGCATCAGGAGGAGGTAGAAGG + Intronic
983059587 4:163142868-163142890 CTGTATGAGGAGAAGTGGGCCGG - Intronic
983588192 4:169378699-169378721 CTGTCTCAAAAAAAGGTGGGGGG - Intergenic
983836240 4:172389611-172389633 CTGCATCTGAAGAAGGTAGGAGG + Intronic
984846663 4:184114207-184114229 CTTTATGAGGCTAAGGTGGGTGG - Intronic
986805459 5:11304707-11304729 TTGTGTCAGGACAAGGTGGTTGG - Intronic
991246734 5:64516623-64516645 CTGTATCAGAATCATGTGGGTGG + Intronic
991917359 5:71618357-71618379 GTGGAACAGCAGAAGGTGGGAGG - Intronic
991929022 5:71733391-71733413 CTGAATTAGCAGAAAGTGGGTGG + Intergenic
992579462 5:78157066-78157088 CTTCAGCAGGAGATGGTGGGGGG + Intronic
992900560 5:81290914-81290936 CTTTAGGAGGACAAGGTGGGTGG + Intergenic
994029143 5:95121033-95121055 CTTTGTCAGGCCAAGGTGGGCGG + Intronic
996094957 5:119388885-119388907 CTTTAGGAGGATAAGGTGGGAGG - Intronic
996479016 5:123952240-123952262 CTGGATCAGGAGTAGAGGGGTGG - Intergenic
997160674 5:131606117-131606139 CTGTATGAGGCCAAGGTGGGTGG + Intronic
998090470 5:139364137-139364159 CTGAATCAGGAGGATGAGGGTGG + Intronic
999352817 5:150892851-150892873 CTTTAAGAGGACAAGGTGGGAGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1001507449 5:172291097-172291119 CTGTAGGAGGCCAAGGTGGGAGG - Intergenic
1001694960 5:173663192-173663214 CTTTTTCAGGAGAAGGAAGGGGG + Intergenic
1002660061 5:180785725-180785747 CAGGATCAGGAGTAGGTGAGCGG - Intergenic
1003353151 6:5339676-5339698 CTGTGGCAGGTCAAGGTGGGTGG - Intronic
1006884819 6:37372596-37372618 CTGTCTCAGGAGAGGGTGCAGGG - Intronic
1007958675 6:45939433-45939455 CTGTAGGAGGCCAAGGTGGGTGG - Intronic
1008877806 6:56348550-56348572 CTGTAGCATGGGAAGGTGGCTGG + Intronic
1013136716 6:107289454-107289476 CTGTGGGAGGACAAGGTGGGTGG + Intronic
1013254312 6:108369520-108369542 CTGTATTAAAAAAAGGTGGGAGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1015802778 6:137077518-137077540 CTTTGTGAGGAAAAGGTGGGAGG + Intergenic
1016979761 6:149843482-149843504 GGGTACCAGGAGGAGGTGGGTGG - Intronic
1018808825 6:167282425-167282447 CTGGAACAGAAAAAGGTGGGGGG + Intronic
1019677220 7:2321209-2321231 CTGTGGCAGGAAACGGTGGGGGG + Intronic
1020003746 7:4770631-4770653 CTGTTTCAGGAAAAGGGGGGCGG + Exonic
1020211500 7:6161366-6161388 CTGCATCAGGAGATGGAGTGGGG + Exonic
1021402262 7:20222780-20222802 CTGTACCTTGAGATGGTGGGTGG - Intergenic
1021453074 7:20799341-20799363 ATTTATAAAGAGAAGGTGGGAGG - Intergenic
1022475738 7:30708356-30708378 GTGTATCTTGGGAAGGTGGGAGG - Intronic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1026303384 7:69118926-69118948 CTTTAAGAGGACAAGGTGGGTGG - Intergenic
1026373066 7:69721295-69721317 CTGAATCAAGTGAAGGAGGGAGG - Intronic
1026741759 7:72983285-72983307 CTGTAGGAGGCCAAGGTGGGCGG - Intergenic
1026785744 7:73300672-73300694 CTGTCTGAGGAGAGGTTGGGCGG + Intergenic
1026801600 7:73403710-73403732 CTGTAGGAGGCCAAGGTGGGCGG - Intergenic
1027101976 7:75381792-75381814 CTGTAGGAGGCCAAGGTGGGCGG + Intergenic
1027108321 7:75419264-75419286 CTGTCTGAGGAGAGGTTGGGTGG - Intronic
1028104269 7:86858523-86858545 CTGTATCATGACATGGTGAGAGG - Intronic
1029383526 7:100228623-100228645 CTTTAGGAGGCGAAGGTGGGAGG + Intronic
1030004387 7:105102029-105102051 CTATATCAGGAGAAGATGGCTGG - Exonic
1030196448 7:106858109-106858131 ATGTAGCAGGAAAAGGAGGGTGG + Intergenic
1031147406 7:118012154-118012176 CTCTATCAGGAAGAGGTGGTAGG + Intergenic
1032175954 7:129626061-129626083 CTGTGGCAGGCCAAGGTGGGAGG - Intronic
1032822247 7:135534779-135534801 CTGTCTCAAAAGAAGATGGGAGG + Intergenic
1033038969 7:137901184-137901206 GTGTAGCAGGAGTGGGTGGGTGG + Intronic
1034256220 7:149725973-149725995 CTGGATGAGGAGAAGCTGGTGGG - Exonic
1036181360 8:6588194-6588216 CTGGACTAGGAGAAGGTGGAGGG - Intronic
1038759266 8:30371520-30371542 CTTTATGAGGCCAAGGTGGGTGG + Intergenic
1041166572 8:55098314-55098336 CTGTAGCTGGAGAAGGGGCGTGG - Intergenic
1041439037 8:57874263-57874285 CTGTAATTGGTGAAGGTGGGAGG - Intergenic
1041748937 8:61238076-61238098 CTGTGTCAGGAAGAGGTGTGGGG - Intronic
1042549609 8:69982691-69982713 CTGTAGGAGGCCAAGGTGGGTGG - Intergenic
1042893672 8:73642279-73642301 CTTTATGAGGCCAAGGTGGGTGG + Intronic
1042920974 8:73919251-73919273 CTGTGGGAGGACAAGGTGGGAGG + Intergenic
1043361635 8:79479310-79479332 CTGTATCAAGAGTGAGTGGGTGG - Intergenic
1044624771 8:94226392-94226414 CTGTAGGAGGCCAAGGTGGGCGG + Intergenic
1046295733 8:112217402-112217424 CAGTATCAAGAGACAGTGGGGGG + Intergenic
1046315984 8:112502239-112502261 CTGTATCAGAAGATGCTTGGGGG - Intronic
1046421394 8:113988086-113988108 GTTTATCAGGAGCAGTTGGGGGG + Intergenic
1047742387 8:127817008-127817030 TTGTATCGGGAGGGGGTGGGGGG - Intergenic
1048601639 8:135924496-135924518 AAGTATCAGATGAAGGTGGGAGG - Intergenic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1049256984 8:141619418-141619440 CTGTATGAGAAGCAGCTGGGAGG - Intergenic
1049324206 8:142013562-142013584 CTGGATCAGGAGACTGTGGGAGG + Intergenic
1049854752 8:144854242-144854264 CTTTATGAGGACTAGGTGGGAGG + Intergenic
1050475656 9:6038070-6038092 CTGAATCACGAGAATGTGGAGGG - Intergenic
1050910502 9:11063447-11063469 CTCTGGCAGGAGAAGGTGGTGGG + Intergenic
1051023930 9:12582668-12582690 CTGTAGATGGAGGAGGTGGGAGG - Intergenic
1051156829 9:14157403-14157425 CTGTTTCTAAAGAAGGTGGGTGG - Intronic
1052558462 9:30051412-30051434 CTATATCAGAAGAAGTTAGGAGG - Intergenic
1053730914 9:41056107-41056129 CTGGAACAGAAGAAGGAGGGCGG - Intergenic
1054697599 9:68375983-68376005 CTGGAACAGAAGAAGGAGGGCGG + Intronic
1055067963 9:72137773-72137795 TTGTAACAGTTGAAGGTGGGGGG - Intronic
1055092949 9:72381126-72381148 ATGTATCTGGAGCAGGTGGGTGG + Intergenic
1055317335 9:75047282-75047304 CTCGAGTAGGAGAAGGTGGGTGG + Intergenic
1055720071 9:79163496-79163518 CTGAAGCAGGAGAAGGTTTGAGG - Intergenic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1055908385 9:81319412-81319434 CTGCATCAGGGGATGGTGAGGGG - Intergenic
1055928835 9:81539013-81539035 CTGAATCAGCAGAAGGTGGGAGG + Intergenic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1056181995 9:84093969-84093991 CTGTATCATGACCAGGTGGCTGG + Intergenic
1057524390 9:95785872-95785894 ATGCCTCAGGACAAGGTGGGAGG + Intergenic
1057986028 9:99715087-99715109 CTGAAGCAGGAGAACCTGGGAGG - Intergenic
1058438076 9:104982202-104982224 CAGAATCAGGAGAAGGTTAGTGG + Intergenic
1059333065 9:113548670-113548692 CTGTATGAGGAGGGGGTGTGAGG - Intronic
1060095951 9:120790508-120790530 ATGTTTCAGGAGCAGGTGTGTGG - Intronic
1061356291 9:130107728-130107750 TTGTATAAGGAGGAGGTTGGGGG + Intronic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1203491355 Un_GL000224v1:108419-108441 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1203503979 Un_KI270741v1:50289-50311 CTGGAGCAGGAGAAAGTGGGTGG + Intergenic
1186613282 X:11159586-11159608 CTGCAGGAGGAGAAGGTTGGGGG + Intronic
1187341553 X:18425756-18425778 CACTCTCAGGAGAAGCTGGGTGG - Intronic
1190085816 X:47394287-47394309 CTGTAGGAGGCCAAGGTGGGAGG - Intronic
1190183159 X:48211211-48211233 CTGTAAGTGGAGAAGGAGGGAGG + Intronic
1190471220 X:50781479-50781501 CTGTATCTGGAATAGCTGGGAGG - Intronic
1191236952 X:58141792-58141814 CTCTATCATTAGAATGTGGGAGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic
1195935998 X:110126271-110126293 CTGGATCAGGAGGAGAGGGGTGG - Intronic
1196681066 X:118470042-118470064 CTTTAGCAGGCCAAGGTGGGTGG - Intergenic
1197173723 X:123462590-123462612 CTTTGCCAGGTGAAGGTGGGAGG + Intronic
1197530772 X:127623059-127623081 CTGTATAAGGAGAACGTGACAGG + Intergenic
1197950937 X:131895791-131895813 CTTTAGCAGGTCAAGGTGGGAGG + Intergenic
1198432763 X:136584419-136584441 GGGTATAAGAAGAAGGTGGGGGG - Intergenic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1201918339 Y:19206615-19206637 ATTTAGCAGGACAAGGTGGGAGG - Intergenic