ID: 924955678

View in Genome Browser
Species Human (GRCh38)
Location 1:248924273-248924295
Sequence CTGGAAGCCAGCAGTCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924955678_924955681 3 Left 924955678 1:248924273-248924295 CCTTCATGACTGCTGGCTTCCAG No data
Right 924955681 1:248924299-248924321 GTGGCGTGCAAACCCAAGCCAGG No data
924955678_924955682 4 Left 924955678 1:248924273-248924295 CCTTCATGACTGCTGGCTTCCAG No data
Right 924955682 1:248924300-248924322 TGGCGTGCAAACCCAAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924955678 Original CRISPR CTGGAAGCCAGCAGTCATGA AGG (reversed) Intergenic
No off target data available for this crispr