ID: 924957687

View in Genome Browser
Species Human (GRCh38)
Location 1:248945017-248945039
Sequence CAAAGGCGGCGCGCCGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924957687_924957695 28 Left 924957687 1:248945017-248945039 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 924957695 1:248945068-248945090 CACACCCGGAGAGCATCGCCAGG No data
924957687_924957694 14 Left 924957687 1:248945017-248945039 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 924957694 1:248945054-248945076 CGTTCTCTTTAGCACACACCCGG No data
924957687_924957696 29 Left 924957687 1:248945017-248945039 CCTGCGCCGGCGCGCCGCCTTTG No data
Right 924957696 1:248945069-248945091 ACACCCGGAGAGCATCGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924957687 Original CRISPR CAAAGGCGGCGCGCCGGCGC AGG (reversed) Intergenic
No off target data available for this crispr