ID: 924957694

View in Genome Browser
Species Human (GRCh38)
Location 1:248945054-248945076
Sequence CGTTCTCTTTAGCACACACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924957687_924957694 14 Left 924957687 1:248945017-248945039 CCTGCGCCGGCGCGCCGCCTTTG 0: 5
1: 5
2: 3
3: 11
4: 109
Right 924957694 1:248945054-248945076 CGTTCTCTTTAGCACACACCCGG No data
924957693_924957694 -3 Left 924957693 1:248945034-248945056 CCTTTGCGAGGGCGGAGTTGCGT No data
Right 924957694 1:248945054-248945076 CGTTCTCTTTAGCACACACCCGG No data
924957689_924957694 8 Left 924957689 1:248945023-248945045 CCGGCGCGCCGCCTTTGCGAGGG No data
Right 924957694 1:248945054-248945076 CGTTCTCTTTAGCACACACCCGG No data
924957692_924957694 0 Left 924957692 1:248945031-248945053 CCGCCTTTGCGAGGGCGGAGTTG No data
Right 924957694 1:248945054-248945076 CGTTCTCTTTAGCACACACCCGG No data
924957684_924957694 29 Left 924957684 1:248945002-248945024 CCGCGCCTCTCTGCGCCTGCGCC No data
Right 924957694 1:248945054-248945076 CGTTCTCTTTAGCACACACCCGG No data
924957686_924957694 24 Left 924957686 1:248945007-248945029 CCTCTCTGCGCCTGCGCCGGCGC No data
Right 924957694 1:248945054-248945076 CGTTCTCTTTAGCACACACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924957694 Original CRISPR CGTTCTCTTTAGCACACACC CGG Intergenic