ID: 924957696

View in Genome Browser
Species Human (GRCh38)
Location 1:248945069-248945091
Sequence ACACCCGGAGAGCATCGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924957689_924957696 23 Left 924957689 1:248945023-248945045 CCGGCGCGCCGCCTTTGCGAGGG No data
Right 924957696 1:248945069-248945091 ACACCCGGAGAGCATCGCCAGGG No data
924957687_924957696 29 Left 924957687 1:248945017-248945039 CCTGCGCCGGCGCGCCGCCTTTG 0: 5
1: 5
2: 3
3: 11
4: 109
Right 924957696 1:248945069-248945091 ACACCCGGAGAGCATCGCCAGGG No data
924957693_924957696 12 Left 924957693 1:248945034-248945056 CCTTTGCGAGGGCGGAGTTGCGT No data
Right 924957696 1:248945069-248945091 ACACCCGGAGAGCATCGCCAGGG No data
924957692_924957696 15 Left 924957692 1:248945031-248945053 CCGCCTTTGCGAGGGCGGAGTTG No data
Right 924957696 1:248945069-248945091 ACACCCGGAGAGCATCGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924957696 Original CRISPR ACACCCGGAGAGCATCGCCA GGG Intergenic