ID: 924958451

View in Genome Browser
Species Human (GRCh38)
Location 2:11534-11556
Sequence TCTGCCAGTGCGCCCCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924958441_924958451 24 Left 924958441 2:11487-11509 CCCCCTGCTTGCAACCGGGCACT No data
Right 924958451 2:11534-11556 TCTGCCAGTGCGCCCCTTGCTGG No data
924958443_924958451 22 Left 924958443 2:11489-11511 CCCTGCTTGCAACCGGGCACTAC No data
Right 924958451 2:11534-11556 TCTGCCAGTGCGCCCCTTGCTGG No data
924958448_924958451 -6 Left 924958448 2:11517-11539 CCGCTTGCCCACGGTGCTCTGCC No data
Right 924958451 2:11534-11556 TCTGCCAGTGCGCCCCTTGCTGG No data
924958442_924958451 23 Left 924958442 2:11488-11510 CCCCTGCTTGCAACCGGGCACTA No data
Right 924958451 2:11534-11556 TCTGCCAGTGCGCCCCTTGCTGG No data
924958446_924958451 10 Left 924958446 2:11501-11523 CCGGGCACTACAGGATCCGCTTG No data
Right 924958451 2:11534-11556 TCTGCCAGTGCGCCCCTTGCTGG No data
924958444_924958451 21 Left 924958444 2:11490-11512 CCTGCTTGCAACCGGGCACTACA No data
Right 924958451 2:11534-11556 TCTGCCAGTGCGCCCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924958451 Original CRISPR TCTGCCAGTGCGCCCCTTGC TGG Intergenic
No off target data available for this crispr