ID: 924960931

View in Genome Browser
Species Human (GRCh38)
Location 2:33849-33871
Sequence CCGTGCAGGCAGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924960931_924960936 -4 Left 924960931 2:33849-33871 CCTTCCTGCCTCTGCCTGCACGG No data
Right 924960936 2:33868-33890 ACGGTCAAATTGTTGACAGTTGG No data
924960931_924960937 24 Left 924960931 2:33849-33871 CCTTCCTGCCTCTGCCTGCACGG No data
Right 924960937 2:33896-33918 TTTCTCTTCTCACCTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924960931 Original CRISPR CCGTGCAGGCAGAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr