ID: 924962184

View in Genome Browser
Species Human (GRCh38)
Location 2:45662-45684
Sequence GGAGAACTTCACCGCGGGGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924962184_924962199 10 Left 924962184 2:45662-45684 CCGACCCCGCGGTGAAGTTCTCC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 924962199 2:45695-45717 CCTCCACCACCTCGGGGTCCAGG 0: 1
1: 0
2: 0
3: 27
4: 292
924962184_924962197 4 Left 924962184 2:45662-45684 CCGACCCCGCGGTGAAGTTCTCC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 924962197 2:45689-45711 CCAGGGCCTCCACCACCTCGGGG 0: 1
1: 0
2: 3
3: 31
4: 301
924962184_924962193 2 Left 924962184 2:45662-45684 CCGACCCCGCGGTGAAGTTCTCC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 924962193 2:45687-45709 CCCCAGGGCCTCCACCACCTCGG 0: 1
1: 0
2: 7
3: 45
4: 658
924962184_924962203 22 Left 924962184 2:45662-45684 CCGACCCCGCGGTGAAGTTCTCC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 924962203 2:45707-45729 CGGGGTCCAGGCCGCAGTACTGG 0: 1
1: 0
2: 0
3: 5
4: 74
924962184_924962195 3 Left 924962184 2:45662-45684 CCGACCCCGCGGTGAAGTTCTCC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 924962195 2:45688-45710 CCCAGGGCCTCCACCACCTCGGG 0: 1
1: 0
2: 4
3: 95
4: 507
924962184_924962205 29 Left 924962184 2:45662-45684 CCGACCCCGCGGTGAAGTTCTCC 0: 1
1: 0
2: 0
3: 2
4: 64
Right 924962205 2:45714-45736 CAGGCCGCAGTACTGGAAGAAGG 0: 1
1: 0
2: 0
3: 17
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924962184 Original CRISPR GGAGAACTTCACCGCGGGGT CGG (reversed) Exonic
902684232 1:18065400-18065422 GGAGTACTTCACACCGGGGCTGG + Intergenic
905659355 1:39709631-39709653 GGAGAAGTGCAGAGCGGGGTGGG - Intronic
908590080 1:65621837-65621859 GGAGAAGTTTATGGCGGGGTTGG + Intronic
916851781 1:168711614-168711636 GCAGAACTTGAGAGCGGGGTTGG - Intronic
1063566000 10:7172500-7172522 CGTGGACTTCACCGCGGGCTCGG - Exonic
1065456909 10:25916435-25916457 GGAGAAATTTATTGCGGGGTTGG - Intergenic
1072427431 10:95341589-95341611 GGAGAACACCACGGCCGGGTGGG - Exonic
1074931523 10:118131517-118131539 GGAGAACTTCTCCACAGGGTGGG + Intergenic
1081548361 11:44089097-44089119 GGAGAAGTTTATGGCGGGGTTGG - Intergenic
1102460240 12:113095338-113095360 GGTGAACTTCTTCCCGGGGTTGG - Exonic
1125594305 15:40874322-40874344 GGAGATCTTCGCCGATGGGTGGG - Intergenic
1129689977 15:77707678-77707700 GCAGAACGTCACAGCTGGGTGGG - Intronic
1135511890 16:23092434-23092456 AGAGAACTTCACAGTGTGGTGGG + Intronic
1135810671 16:25583998-25584020 GGAGAAGTTTACAGTGGGGTTGG - Intergenic
1139358375 16:66381043-66381065 GGAAAATTTCACGGCAGGGTTGG - Intronic
1149800002 17:59558316-59558338 GGAGAAGTTTATTGCGGGGTTGG - Intergenic
1160851384 19:1194562-1194584 GGAGGATCTCACCGCGGGGCGGG + Intronic
1161156291 19:2733320-2733342 GGAGACCTTCAACGCCGGATCGG - Exonic
1168518130 19:57025819-57025841 GGAGAAGTTTATTGCGGGGTTGG + Intergenic
924962184 2:45662-45684 GGAGAACTTCACCGCGGGGTCGG - Exonic
933572182 2:84026611-84026633 GGAGATGTTCACCTTGGGGTAGG + Intergenic
936011717 2:108929314-108929336 GGAAAACTTCTCCGCCGGGCAGG + Exonic
946636886 2:221739138-221739160 GGAGAACAGCACCGAGGGGATGG + Intergenic
1169056468 20:2625864-2625886 GGAGAATTTCACCGGAGAGTTGG - Intronic
1178687022 21:34720009-34720031 GGGGAACTTCAGGGCAGGGTGGG - Intergenic
1178831870 21:36063069-36063091 GGAGAAGTTCATGGCAGGGTTGG - Intronic
1179579223 21:42329561-42329583 GGAGAACTTTATGGTGGGGTTGG - Intergenic
1180162266 21:46003379-46003401 GGAGAACGTGACTGCGGGGCGGG - Exonic
1180963343 22:19772844-19772866 AGGGACCTTCACCGCGGGGCTGG + Intronic
1183218419 22:36496212-36496234 GGAGAACAGCAACGCGGGGGAGG + Intronic
1183258418 22:36778019-36778041 GGAGAAGTTTACTGTGGGGTTGG - Intergenic
1183391041 22:37545896-37545918 GGAGACCTCCACGGAGGGGTGGG - Intergenic
1183487980 22:38099742-38099764 GGAGGACGTGTCCGCGGGGTTGG - Intronic
1183543695 22:38444370-38444392 GGAGAACTTCCCAGCGGAGGTGG + Intronic
949876189 3:8627661-8627683 AGAGCACTTCACCGCGGTGCTGG + Intronic
954368072 3:50156565-50156587 GGAAAACTGCACCCAGGGGTTGG + Intronic
960653511 3:119978298-119978320 GGAGAATTTTATGGCGGGGTTGG - Intronic
963714602 3:148788470-148788492 CGAGGACTTCACCGCGGAGGTGG - Intergenic
969354914 4:6619622-6619644 GGAGAACTCCGCGGTGGGGTGGG + Intronic
972267873 4:37480633-37480655 GGAGAAGTTCATGGCAGGGTTGG + Intronic
982358311 4:154492073-154492095 GGAGACGTGCACCGCGGGGCGGG + Intergenic
984433426 4:179678059-179678081 GGAGAAGTTTATGGCGGGGTTGG + Intergenic
984862515 4:184253218-184253240 GGAGCACATCACGGCGGGGGTGG - Intergenic
984880272 4:184404736-184404758 AGAGAAGATCACCGCGGGGCCGG + Intronic
985060468 4:186072663-186072685 GGAGAACAGCACCGAGGGGGTGG + Intronic
986233986 5:5890735-5890757 GGAGAAGGTCAACGCAGGGTTGG - Intergenic
986579468 5:9249891-9249913 GGAGAACTGGACCCCAGGGTGGG + Intronic
994903284 5:105803600-105803622 GGAGAAGTTTACGGTGGGGTTGG + Intergenic
995086733 5:108119430-108119452 GAAGAACTTCACAGCTGGCTGGG - Intronic
998203080 5:140140795-140140817 GGAGAACTTCAACCCTGTGTTGG - Intergenic
1002888195 6:1313486-1313508 GGAGAACTTGCCCGCGGGGCTGG - Exonic
1005787715 6:29263282-29263304 GGAGAAGTTTATGGCGGGGTTGG - Intergenic
1007327258 6:41072363-41072385 GGAGCCCTTCCCCGCGGGGCGGG - Exonic
1018731839 6:166657158-166657180 GGAGAACTTCATCATGGGCTAGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019869979 7:3751436-3751458 GAAGAACTTCGGCGGGGGGTGGG + Intronic
1024319309 7:48049085-48049107 GGAGAAGTTCATGGCTGGGTTGG - Intronic
1040718042 8:50282212-50282234 GGAGAAGTTTACTGTGGGGTTGG - Intronic
1049725320 8:144143041-144143063 GGAGAACTCCACCGGGGCCTCGG + Intergenic
1050726916 9:8660578-8660600 GGAGAAGTTCACTGAGGGGCTGG - Intronic
1051876988 9:21803343-21803365 GGAAAACTTCAGCGCGGAGAAGG - Intronic
1053613675 9:39742011-39742033 GGAGAAGCTCATGGCGGGGTTGG + Intergenic
1054553972 9:66634913-66634935 GGAGAAGCTCATGGCGGGGTTGG - Intergenic
1058935634 9:109767253-109767275 GGAGACCTTCACTCTGGGGTTGG - Intronic
1060733222 9:126050737-126050759 GGAGACCTTCACAGCGTGGCTGG + Intergenic
1201440697 Y:14005063-14005085 GGACAACGTCACCCCTGGGTGGG + Intergenic
1201443874 Y:14037645-14037667 GGACAACGTCACCCCTGGGTGGG - Intergenic