ID: 924963720

View in Genome Browser
Species Human (GRCh38)
Location 2:57321-57343
Sequence CTGTGCAAGGGTAGGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924963720_924963731 11 Left 924963720 2:57321-57343 CCCTGCACCCTACCCTTGCACAG No data
Right 924963731 2:57355-57377 AAAGTCTGGGCTATAGGCCCGGG No data
924963720_924963733 28 Left 924963720 2:57321-57343 CCCTGCACCCTACCCTTGCACAG No data
Right 924963733 2:57372-57394 CCCGGGCCTATGTGTACTCTTGG No data
924963720_924963727 -2 Left 924963720 2:57321-57343 CCCTGCACCCTACCCTTGCACAG No data
Right 924963727 2:57342-57364 AGCTGCAGCTGCCAAAGTCTGGG No data
924963720_924963728 5 Left 924963720 2:57321-57343 CCCTGCACCCTACCCTTGCACAG No data
Right 924963728 2:57349-57371 GCTGCCAAAGTCTGGGCTATAGG No data
924963720_924963726 -3 Left 924963720 2:57321-57343 CCCTGCACCCTACCCTTGCACAG No data
Right 924963726 2:57341-57363 CAGCTGCAGCTGCCAAAGTCTGG No data
924963720_924963730 10 Left 924963720 2:57321-57343 CCCTGCACCCTACCCTTGCACAG No data
Right 924963730 2:57354-57376 CAAAGTCTGGGCTATAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924963720 Original CRISPR CTGTGCAAGGGTAGGGTGCA GGG (reversed) Intergenic
No off target data available for this crispr