ID: 924964734

View in Genome Browser
Species Human (GRCh38)
Location 2:65317-65339
Sequence ACCCACTGCAAGCCTGGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924964727_924964734 27 Left 924964727 2:65267-65289 CCAGGGGAAAGAGGAAGACAGTG No data
Right 924964734 2:65317-65339 ACCCACTGCAAGCCTGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924964734 Original CRISPR ACCCACTGCAAGCCTGGTAA AGG Intergenic
No off target data available for this crispr