ID: 924966626 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:82414-82436 |
| Sequence | ATTCCCTTTAGACAAGTTAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 924966626_924966627 | -10 | Left | 924966626 | 2:82414-82436 | CCAATAACTTGTCTAAAGGGAAT | No data | ||
| Right | 924966627 | 2:82427-82449 | TAAAGGGAATATTTTATTCCTGG | No data | ||||
| 924966626_924966628 | -9 | Left | 924966626 | 2:82414-82436 | CCAATAACTTGTCTAAAGGGAAT | No data | ||
| Right | 924966628 | 2:82428-82450 | AAAGGGAATATTTTATTCCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 924966626 | Original CRISPR | ATTCCCTTTAGACAAGTTAT TGG (reversed) | Intergenic | ||