ID: 924966626

View in Genome Browser
Species Human (GRCh38)
Location 2:82414-82436
Sequence ATTCCCTTTAGACAAGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924966626_924966627 -10 Left 924966626 2:82414-82436 CCAATAACTTGTCTAAAGGGAAT No data
Right 924966627 2:82427-82449 TAAAGGGAATATTTTATTCCTGG No data
924966626_924966628 -9 Left 924966626 2:82414-82436 CCAATAACTTGTCTAAAGGGAAT No data
Right 924966628 2:82428-82450 AAAGGGAATATTTTATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924966626 Original CRISPR ATTCCCTTTAGACAAGTTAT TGG (reversed) Intergenic