ID: 924966627

View in Genome Browser
Species Human (GRCh38)
Location 2:82427-82449
Sequence TAAAGGGAATATTTTATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924966626_924966627 -10 Left 924966626 2:82414-82436 CCAATAACTTGTCTAAAGGGAAT No data
Right 924966627 2:82427-82449 TAAAGGGAATATTTTATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924966627 Original CRISPR TAAAGGGAATATTTTATTCC TGG Intergenic