ID: 924966628

View in Genome Browser
Species Human (GRCh38)
Location 2:82428-82450
Sequence AAAGGGAATATTTTATTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924966626_924966628 -9 Left 924966626 2:82414-82436 CCAATAACTTGTCTAAAGGGAAT No data
Right 924966628 2:82428-82450 AAAGGGAATATTTTATTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924966628 Original CRISPR AAAGGGAATATTTTATTCCT GGG Intergenic