ID: 924968509

View in Genome Browser
Species Human (GRCh38)
Location 2:100953-100975
Sequence CATTCTGACCAGGATGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924968509_924968515 -3 Left 924968509 2:100953-100975 CCAACTCCATCCTGGTCAGAATG No data
Right 924968515 2:100973-100995 ATGGAGGGTTATTGTGACCATGG No data
924968509_924968517 14 Left 924968509 2:100953-100975 CCAACTCCATCCTGGTCAGAATG No data
Right 924968517 2:100990-101012 CCATGGCTTTCTCTTTTCTCAGG No data
924968509_924968518 15 Left 924968509 2:100953-100975 CCAACTCCATCCTGGTCAGAATG No data
Right 924968518 2:100991-101013 CATGGCTTTCTCTTTTCTCAGGG No data
924968509_924968519 20 Left 924968509 2:100953-100975 CCAACTCCATCCTGGTCAGAATG No data
Right 924968519 2:100996-101018 CTTTCTCTTTTCTCAGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924968509 Original CRISPR CATTCTGACCAGGATGGAGT TGG (reversed) Intergenic
No off target data available for this crispr