ID: 924970639

View in Genome Browser
Species Human (GRCh38)
Location 2:124409-124431
Sequence CTGTGGCTCTGACGGTCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924970639_924970646 14 Left 924970639 2:124409-124431 CCCTAAGACCGTCAGAGCCACAG No data
Right 924970646 2:124446-124468 ATGAGGTCAAAGGCTGACCCAGG No data
924970639_924970644 -3 Left 924970639 2:124409-124431 CCCTAAGACCGTCAGAGCCACAG No data
Right 924970644 2:124429-124451 CAGGACACAGAGACAGCATGAGG No data
924970639_924970647 15 Left 924970639 2:124409-124431 CCCTAAGACCGTCAGAGCCACAG No data
Right 924970647 2:124447-124469 TGAGGTCAAAGGCTGACCCAGGG No data
924970639_924970648 22 Left 924970639 2:124409-124431 CCCTAAGACCGTCAGAGCCACAG No data
Right 924970648 2:124454-124476 AAAGGCTGACCCAGGGTGAGTGG No data
924970639_924970645 4 Left 924970639 2:124409-124431 CCCTAAGACCGTCAGAGCCACAG No data
Right 924970645 2:124436-124458 CAGAGACAGCATGAGGTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924970639 Original CRISPR CTGTGGCTCTGACGGTCTTA GGG (reversed) Intergenic
No off target data available for this crispr