ID: 924970799

View in Genome Browser
Species Human (GRCh38)
Location 2:126228-126250
Sequence CATGAGAGGGAAACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924970799_924970804 -8 Left 924970799 2:126228-126250 CCTTCCACAGTTTCCCTCTCATG No data
Right 924970804 2:126243-126265 CTCTCATGCGGAGCCGAAGCTGG 0: 125
1: 119
2: 538
3: 536
4: 285
924970799_924970806 13 Left 924970799 2:126228-126250 CCTTCCACAGTTTCCCTCTCATG No data
Right 924970806 2:126264-126286 GGACTGTACTGCTGCGATCTCGG 0: 17
1: 810
2: 531
3: 1422
4: 25844

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924970799 Original CRISPR CATGAGAGGGAAACTGTGGA AGG (reversed) Intergenic
No off target data available for this crispr