ID: 924971339

View in Genome Browser
Species Human (GRCh38)
Location 2:130352-130374
Sequence GAAAATCAGGAGAAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924971336_924971339 -7 Left 924971336 2:130336-130358 CCTCTTATCTTCAAATGAAAATC No data
Right 924971339 2:130352-130374 GAAAATCAGGAGAAGTAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924971339 Original CRISPR GAAAATCAGGAGAAGTAGGC AGG Intergenic
No off target data available for this crispr