ID: 924973622

View in Genome Browser
Species Human (GRCh38)
Location 2:153902-153924
Sequence CGACAAACAGCACTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924973615_924973622 23 Left 924973615 2:153856-153878 CCTGTTGGATCCGGAGGGGTGGA No data
Right 924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG No data
924973613_924973622 24 Left 924973613 2:153855-153877 CCCTGTTGGATCCGGAGGGGTGG No data
Right 924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG No data
924973617_924973622 13 Left 924973617 2:153866-153888 CCGGAGGGGTGGAAGTCAGTGGT No data
Right 924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924973622 Original CRISPR CGACAAACAGCACTGGTGGA CGG Intergenic
No off target data available for this crispr