ID: 924974161

View in Genome Browser
Species Human (GRCh38)
Location 2:157652-157674
Sequence CTGTCACCTGACTCTTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974161_924974170 28 Left 924974161 2:157652-157674 CCTTCAAAAGAGTCAGGTGACAG No data
Right 924974170 2:157703-157725 AGTCTCTCCAGAAAGGCAGTAGG No data
924974161_924974167 21 Left 924974161 2:157652-157674 CCTTCAAAAGAGTCAGGTGACAG No data
Right 924974167 2:157696-157718 CTCCCTTAGTCTCTCCAGAAAGG 0: 64
1: 38
2: 15
3: 52
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974161 Original CRISPR CTGTCACCTGACTCTTTTGA AGG (reversed) Intergenic
No off target data available for this crispr