ID: 924974508

View in Genome Browser
Species Human (GRCh38)
Location 2:160386-160408
Sequence CGACAAACAGCCGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974500_924974508 24 Left 924974500 2:160339-160361 CCCTGTCAGATCCGGAGGGGTGG No data
Right 924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG No data
924974504_924974508 13 Left 924974504 2:160350-160372 CCGGAGGGGTGGAAGTCAGTGGC 0: 20
1: 67
2: 87
3: 104
4: 238
Right 924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG No data
924974502_924974508 23 Left 924974502 2:160340-160362 CCTGTCAGATCCGGAGGGGTGGA No data
Right 924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974508 Original CRISPR CGACAAACAGCCGTGGTGGA TGG Intergenic
No off target data available for this crispr