ID: 924974629

View in Genome Browser
Species Human (GRCh38)
Location 2:161413-161435
Sequence AGGGTCCCCACACATAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924974629_924974636 -1 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974636 2:161435-161457 TGTGGGGAAACAGTTGCATCGGG No data
924974629_924974640 9 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974640 2:161445-161467 CAGTTGCATCGGGGCCGGGATGG No data
924974629_924974642 21 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG No data
924974629_924974645 23 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974645 2:161459-161481 CCGGGATGGTGGTTCCACTGGGG No data
924974629_924974637 0 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974637 2:161436-161458 GTGGGGAAACAGTTGCATCGGGG No data
924974629_924974639 5 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974639 2:161441-161463 GAAACAGTTGCATCGGGGCCGGG No data
924974629_924974635 -2 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974635 2:161434-161456 CTGTGGGGAAACAGTTGCATCGG No data
924974629_924974643 22 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974643 2:161458-161480 GCCGGGATGGTGGTTCCACTGGG No data
924974629_924974641 12 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974641 2:161448-161470 TTGCATCGGGGCCGGGATGGTGG No data
924974629_924974638 4 Left 924974629 2:161413-161435 CCATGGCTATGTGTGGGGACCCT No data
Right 924974638 2:161440-161462 GGAAACAGTTGCATCGGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924974629 Original CRISPR AGGGTCCCCACACATAGCCA TGG (reversed) Intergenic